Incidental Mutation 'R1264:Clstn2'
ID151115
Institutional Source Beutler Lab
Gene Symbol Clstn2
Ensembl Gene ENSMUSG00000032452
Gene Namecalsyntenin 2
SynonymsCst-2, CSTN2, CS2, 2900042C18Rik
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location97444395-98033181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97457609 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 770 (R770G)
Ref Sequence ENSEMBL: ENSMUSP00000124081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]
Predicted Effect probably benign
Transcript: ENSMUST00000035027
AA Change: R770G

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: R770G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
SCOP:d1a8d_1 358 538 5e-21 SMART
Blast:LamG 380 529 3e-41 BLAST
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162295
AA Change: R770G

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: R770G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
Pfam:Laminin_G_3 356 533 1.4e-9 PFAM
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Clstn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Clstn2 APN 9 97582452 splice site probably benign
IGL00563:Clstn2 APN 9 97582452 splice site probably benign
IGL00733:Clstn2 APN 9 97483049 missense probably damaging 1.00
IGL01303:Clstn2 APN 9 97483075 nonsense probably null
IGL01935:Clstn2 APN 9 97463468 missense probably damaging 1.00
IGL02157:Clstn2 APN 9 97541875 missense probably benign
IGL02974:Clstn2 APN 9 97532707 missense probably damaging 1.00
IGL03164:Clstn2 APN 9 97799409 missense possibly damaging 0.50
IGL03298:Clstn2 APN 9 97456572 missense probably damaging 1.00
R0653:Clstn2 UTSW 9 97458204 missense probably damaging 1.00
R0845:Clstn2 UTSW 9 97570628 missense probably benign 0.39
R0992:Clstn2 UTSW 9 97445712 missense probably benign 0.00
R1105:Clstn2 UTSW 9 97583499 splice site probably null
R1112:Clstn2 UTSW 9 97458228 missense possibly damaging 0.92
R1275:Clstn2 UTSW 9 97457430 missense probably benign 0.00
R1329:Clstn2 UTSW 9 97458174 missense probably damaging 1.00
R1396:Clstn2 UTSW 9 97461393 missense probably benign 0.02
R1556:Clstn2 UTSW 9 97456505 missense probably benign 0.41
R1703:Clstn2 UTSW 9 97458237 missense possibly damaging 0.90
R1837:Clstn2 UTSW 9 97583540 missense probably benign 0.00
R2911:Clstn2 UTSW 9 97532722 missense probably damaging 1.00
R3434:Clstn2 UTSW 9 97454715 missense probably benign 0.17
R3771:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3772:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3854:Clstn2 UTSW 9 97463595 nonsense probably null
R4049:Clstn2 UTSW 9 97457560 missense possibly damaging 0.59
R4334:Clstn2 UTSW 9 97463528 missense probably damaging 1.00
R4705:Clstn2 UTSW 9 97463559 missense possibly damaging 0.95
R4755:Clstn2 UTSW 9 97445673 missense probably benign 0.01
R4884:Clstn2 UTSW 9 97799395 missense probably damaging 1.00
R5017:Clstn2 UTSW 9 97483086 missense probably damaging 1.00
R5076:Clstn2 UTSW 9 97483079 missense probably damaging 1.00
R5122:Clstn2 UTSW 9 97461421 missense probably damaging 1.00
R5155:Clstn2 UTSW 9 97456431 missense probably benign 0.02
R5560:Clstn2 UTSW 9 97469819 missense possibly damaging 0.95
R6009:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6011:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6029:Clstn2 UTSW 9 97456581 missense probably benign 0.00
R6093:Clstn2 UTSW 9 97458210 missense probably damaging 1.00
R6284:Clstn2 UTSW 9 97454674 missense probably benign
R6676:Clstn2 UTSW 9 97461531 missense probably damaging 1.00
R6902:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6946:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6966:Clstn2 UTSW 9 97526406 nonsense probably null
R7329:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7330:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7382:Clstn2 UTSW 9 97799398 nonsense probably null
R7410:Clstn2 UTSW 9 97541867 missense probably benign 0.06
R7549:Clstn2 UTSW 9 97582544 missense probably benign 0.01
X0027:Clstn2 UTSW 9 97526399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACCTGAACTGCGCTGGATAC -3'
(R):5'- ACCCCTATGGCACAAGTCTGTCTC -3'

Sequencing Primer
(F):5'- GAACTGCGCTGGATACTACTC -3'
(R):5'- ACAAGTCTGTCTCCTGTGTC -3'
Posted On2014-01-29