Incidental Mutation 'R1264:Kif13b'
ID151124
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 64776232 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect probably benign
Transcript: ENSMUST00000100473
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224503
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1624:Kif13b UTSW 14 64738619 missense probably damaging 0.99
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3727:Kif13b UTSW 14 64765748 splice site probably benign
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4692:Kif13b UTSW 14 64803575 missense probably benign 0.05
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5037:Kif13b UTSW 14 64758589 nonsense probably null
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5408:Kif13b UTSW 14 64779689 critical splice acceptor site probably null
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R5891:Kif13b UTSW 14 64788405 splice site probably null
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7217:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
Predicted Primers PCR Primer
(F):5'- AAGCGTCACCAGTCCTTGCTTCCA -3'
(R):5'- AGCATCCCCAGCCCGTTTCATTGA -3'

Sequencing Primer
(F):5'- GGCACATTATAGGTCCCAGTC -3'
(R):5'- CAGCCCGTTTCATTGACTATG -3'
Posted On2014-01-29