Incidental Mutation 'R1264:H2-M9'
ID151126
Institutional Source Beutler Lab
Gene Symbol H2-M9
Ensembl Gene ENSMUSG00000067201
Gene Namehistocompatibility 2, M region locus 9
SynonymsM9
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36639285-36642666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36642592 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 18 (V18A)
Ref Sequence ENSEMBL: ENSMUSP00000084411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087165] [ENSMUST00000087167]
Predicted Effect probably benign
Transcript: ENSMUST00000087165
AA Change: V18A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084409
Gene: ENSMUSG00000067201
AA Change: V18A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.4e-45 PFAM
transmembrane domain 216 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087167
AA Change: V18A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084411
Gene: ENSMUSG00000067201
AA Change: V18A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 5.3e-44 PFAM
IGc1 222 293 5.73e-22 SMART
transmembrane domain 308 330 N/A INTRINSIC
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in H2-M9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:H2-M9 APN 17 36641819 splice site probably null
IGL02133:H2-M9 APN 17 36641737 missense possibly damaging 0.95
IGL02323:H2-M9 APN 17 36640741 missense probably damaging 1.00
IGL02957:H2-M9 APN 17 36642157 missense probably benign 0.00
IGL03127:H2-M9 APN 17 36640822 missense possibly damaging 0.48
R0025:H2-M9 UTSW 17 36641755 missense probably damaging 1.00
R0026:H2-M9 UTSW 17 36641527 splice site probably benign
R0926:H2-M9 UTSW 17 36641773 missense probably damaging 0.98
R1171:H2-M9 UTSW 17 36641653 missense probably benign 0.14
R1995:H2-M9 UTSW 17 36641786 missense probably damaging 1.00
R4622:H2-M9 UTSW 17 36641824 splice site probably null
R4737:H2-M9 UTSW 17 36640739 nonsense probably null
R4808:H2-M9 UTSW 17 36640792 missense probably damaging 0.99
R5176:H2-M9 UTSW 17 36641631 missense probably damaging 0.98
R6756:H2-M9 UTSW 17 36642335 missense probably damaging 1.00
R6785:H2-M9 UTSW 17 36642233 missense probably damaging 0.99
X0018:H2-M9 UTSW 17 36641722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGAGCCAATGCCAGTCCACAGG -3'
(R):5'- ACATACTGCACTTATGTTCCCACGC -3'

Sequencing Primer
(F):5'- GGCCTATTCCCAAGGAAGG -3'
(R):5'- GGACTGCTCTTACAAGAGTTCATC -3'
Posted On2014-01-29