Incidental Mutation 'R1264:Cndp2'
ID151130
Institutional Source Beutler Lab
Gene Symbol Cndp2
Ensembl Gene ENSMUSG00000024644
Gene NameCNDP dipeptidase 2 (metallopeptidase M20 family)
SynonymsPep1, Dip-2, 0610010E05Rik, Cn2, Pep-1
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84667470-84685633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84678791 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 95 (C95F)
Ref Sequence ENSEMBL: ENSMUSP00000128696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025546] [ENSMUST00000168419]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025546
AA Change: C95F

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025546
Gene: ENSMUSG00000024644
AA Change: C95F

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.8e-35 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168419
AA Change: C95F

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128696
Gene: ENSMUSG00000024644
AA Change: C95F

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.2e-33 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNDP2, also known as tissue carnosinase and peptidase A (EC 3.4.13.18), is a nonspecific dipeptidase rather than a selective carnosinase (Teufel et al., 2003 [PubMed 12473676]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Cndp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Cndp2 APN 18 84677376 missense probably damaging 1.00
IGL01143:Cndp2 APN 18 84677317 critical splice donor site probably null
IGL01310:Cndp2 APN 18 84670877 missense possibly damaging 0.95
IGL01408:Cndp2 APN 18 84670911 missense probably benign
IGL01520:Cndp2 APN 18 84668607 missense probably benign 0.03
IGL02095:Cndp2 APN 18 84681032 missense possibly damaging 0.67
R1108:Cndp2 UTSW 18 84675060 missense probably damaging 1.00
R1466:Cndp2 UTSW 18 84677315 splice site probably benign
R1584:Cndp2 UTSW 18 84677315 splice site probably benign
R2363:Cndp2 UTSW 18 84668569 missense probably damaging 0.96
R2383:Cndp2 UTSW 18 84675090 missense possibly damaging 0.82
R3153:Cndp2 UTSW 18 84668597 missense probably benign 0.02
R4590:Cndp2 UTSW 18 84669808 missense probably damaging 1.00
R4788:Cndp2 UTSW 18 84675164 missense probably damaging 1.00
R5033:Cndp2 UTSW 18 84670829 missense possibly damaging 0.94
R5154:Cndp2 UTSW 18 84668602 missense probably benign 0.00
R5178:Cndp2 UTSW 18 84675028 missense probably benign 0.00
R5326:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5542:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5556:Cndp2 UTSW 18 84672124 missense probably benign 0.38
R5722:Cndp2 UTSW 18 84668078 nonsense probably null
R6431:Cndp2 UTSW 18 84675078 nonsense probably null
R6682:Cndp2 UTSW 18 84677330 missense probably benign 0.00
R7036:Cndp2 UTSW 18 84669945 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTCCCACCGAGGACTTGTTATG -3'
(R):5'- ACGCAGGCTGATGGATGACAAC -3'

Sequencing Primer
(F):5'- TGAGGCACAAATGAGAAACTTCC -3'
(R):5'- TGGATGACAACAGACAAGACC -3'
Posted On2014-01-29