Incidental Mutation 'R1264:Olfr1427'
ID151132
Institutional Source Beutler Lab
Gene Symbol Olfr1427
Ensembl Gene ENSMUSG00000067525
Gene Nameolfactory receptor 1427
SynonymsMOR239-4, GA_x6K02T2RE5P-2458473-2457538
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12098006-12103334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12098834 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 268 (D268E)
Ref Sequence ENSEMBL: ENSMUSP00000150457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087825] [ENSMUST00000215374] [ENSMUST00000216069]
Predicted Effect probably benign
Transcript: ENSMUST00000087825
AA Change: D268E

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085127
Gene: ENSMUSG00000067525
AA Change: D268E

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.4e-47 PFAM
Pfam:7tm_1 41 304 6.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215374
AA Change: D268E

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216069
AA Change: D268E

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216845
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Olfr1427
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr1427 APN 19 12099405 missense probably benign 0.00
IGL01520:Olfr1427 APN 19 12099636 start codon destroyed probably null 0.98
IGL01768:Olfr1427 APN 19 12099039 missense probably damaging 1.00
IGL02060:Olfr1427 APN 19 12099460 missense probably damaging 1.00
IGL02328:Olfr1427 APN 19 12098782 missense probably damaging 1.00
R0346:Olfr1427 UTSW 19 12099439 missense probably damaging 0.96
R1702:Olfr1427 UTSW 19 12099166 missense probably benign 0.25
R1709:Olfr1427 UTSW 19 12098881 missense probably damaging 1.00
R4781:Olfr1427 UTSW 19 12099367 missense probably benign 0.01
R4821:Olfr1427 UTSW 19 12098746 missense probably benign 0.00
R5509:Olfr1427 UTSW 19 12098977 missense possibly damaging 0.94
R5668:Olfr1427 UTSW 19 12098926 missense probably damaging 0.99
R6156:Olfr1427 UTSW 19 12099120 missense possibly damaging 0.87
R6619:Olfr1427 UTSW 19 12099363 missense probably damaging 0.99
R6950:Olfr1427 UTSW 19 12099390 missense probably benign 0.00
R7008:Olfr1427 UTSW 19 12098850 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACCATTGATAGGCAACTCAGGTGC -3'
(R):5'- TGATGTCCCACAGGTCCTCAAACTC -3'

Sequencing Primer
(F):5'- CAACTCAGGTGCTTCTATTATAGTTC -3'
(R):5'- AATGGCCTGATCACTACGCTATG -3'
Posted On2014-01-29