Incidental Mutation 'R1264:Plekhs1'
ID151133
Institutional Source Beutler Lab
Gene Symbol Plekhs1
Ensembl Gene ENSMUSG00000035818
Gene Namepleckstrin homology domain containing, family S member 1
Synonyms9930023K05Rik
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56461640-56486752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56485763 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 447 (V447A)
Ref Sequence ENSEMBL: ENSMUSP00000136674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039666] [ENSMUST00000178590]
Predicted Effect probably benign
Transcript: ENSMUST00000039666
AA Change: V447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035440
Gene: ENSMUSG00000035818
AA Change: V447A

DomainStartEndE-ValueType
PH 21 137 4.68e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178590
AA Change: V447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136674
Gene: ENSMUSG00000035818
AA Change: V447A

DomainStartEndE-ValueType
PH 21 136 1.77e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225008
Meta Mutation Damage Score 0.1588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Plekhs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Plekhs1 APN 19 56464599 critical splice donor site probably null
IGL01387:Plekhs1 APN 19 56470971 missense probably benign 0.00
IGL02506:Plekhs1 APN 19 56471766 missense probably damaging 1.00
FR4304:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4340:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4342:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4342:Plekhs1 UTSW 19 56479861 unclassified probably benign
FR4589:Plekhs1 UTSW 19 56479863 unclassified probably benign
FR4737:Plekhs1 UTSW 19 56479863 unclassified probably benign
IGL03052:Plekhs1 UTSW 19 56470757 missense probably benign 0.43
R0023:Plekhs1 UTSW 19 56478516 missense probably damaging 0.99
R0023:Plekhs1 UTSW 19 56478516 missense probably damaging 0.99
R0100:Plekhs1 UTSW 19 56478502 missense probably damaging 1.00
R0100:Plekhs1 UTSW 19 56478502 missense probably damaging 1.00
R0129:Plekhs1 UTSW 19 56477290 critical splice donor site probably null
R0498:Plekhs1 UTSW 19 56481104 unclassified probably null
R1528:Plekhs1 UTSW 19 56479995 missense probably damaging 1.00
R1650:Plekhs1 UTSW 19 56471042 missense probably damaging 1.00
R1820:Plekhs1 UTSW 19 56478522 missense possibly damaging 0.48
R2884:Plekhs1 UTSW 19 56470826 missense probably benign 0.01
R3237:Plekhs1 UTSW 19 56464600 splice site probably null
R4395:Plekhs1 UTSW 19 56479894 missense probably benign
R4825:Plekhs1 UTSW 19 56473268 splice site probably null
R5484:Plekhs1 UTSW 19 56479828 missense possibly damaging 0.82
R5511:Plekhs1 UTSW 19 56485792 missense probably damaging 0.97
R7105:Plekhs1 UTSW 19 56477215 missense probably damaging 0.99
R7267:Plekhs1 UTSW 19 56470777 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGGTTTCCTTCAAGAACAGACGC -3'
(R):5'- ATGCAGCCTTGTCTCCAGTCACAC -3'

Sequencing Primer
(F):5'- gggaatggggagagaggg -3'
(R):5'- TTTTTGATGGCAGGGCTCCT -3'
Posted On2014-01-29