Incidental Mutation 'R1265:Nsd3'
ID151143
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission 039332-MU
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R1265 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25682562 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 779 (V779A)
Ref Sequence ENSEMBL: ENSMUSP00000117778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000146919]
Predicted Effect probably benign
Transcript: ENSMUST00000084026
AA Change: V779A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: V779A

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139966
AA Change: V779A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: V779A

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141781
Predicted Effect probably benign
Transcript: ENSMUST00000142395
AA Change: V779A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: V779A

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146919
SMART Domains Protein: ENSMUSP00000115470
Gene: ENSMUSG00000054823

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210452
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,946,722 D316G possibly damaging Het
Aebp1 T C 11: 5,871,740 V713A probably damaging Het
Alg2 T C 4: 47,474,289 probably benign Het
Ank1 T A 8: 23,117,037 V1273E possibly damaging Het
Cntnap5a A G 1: 116,428,518 T760A possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Igf2r A T 17: 12,694,124 V1779E probably damaging Het
Lrp1b C T 2: 41,476,654 V537M probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Ly6h T A 15: 75,566,183 M27L probably benign Het
Nphs2 A G 1: 156,318,747 T173A probably damaging Het
Olfr411 T C 11: 74,346,940 I95V probably benign Het
Pdzd7 T C 19: 45,040,685 D82G possibly damaging Het
Pkp2 A G 16: 16,225,304 N76S probably benign Het
Ppip5k2 A G 1: 97,719,900 S976P probably benign Het
Slc38a3 A G 9: 107,651,986 F489S probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Tbx10 T C 19: 3,996,625 F35S probably damaging Het
Tcf4 T C 18: 69,642,932 M40T possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Thsd7a T C 6: 12,317,419 N1630S probably damaging Het
Urb2 A G 8: 124,025,153 D75G probably damaging Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATGTAGCTCAGAGTCCTCAC -3'
(R):5'- TGAATGCTTGAATTGCAACGTAGCC -3'

Sequencing Primer
(F):5'- TAGGATGCCCAAGGCCC -3'
(R):5'- AAGTCAACTGTGTGTCTCAGC -3'
Posted On2014-01-29