Incidental Mutation 'R1266:Brix1'
ID151176
Institutional Source Beutler Lab
Gene Symbol Brix1
Ensembl Gene ENSMUSG00000022247
Gene NameBRX1, biogenesis of ribosomes
Synonyms1110064N10Rik, Bxdc2
MMRRC Submission 039333-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1266 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10474779-10485947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10478761 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 191 (T191A)
Ref Sequence ENSEMBL: ENSMUSP00000022855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022855] [ENSMUST00000168761] [ENSMUST00000169050]
Predicted Effect probably damaging
Transcript: ENSMUST00000022855
AA Change: T191A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022855
Gene: ENSMUSG00000022247
AA Change: T191A

DomainStartEndE-ValueType
Brix 63 243 3.62e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168690
SMART Domains Protein: ENSMUSP00000132283
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 22 147 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168761
SMART Domains Protein: ENSMUSP00000130602
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Blast:Brix 10 51 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169050
SMART Domains Protein: ENSMUSP00000127437
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Pfam:Brix 72 154 8.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob C A 12: 8,006,093 T1492N probably benign Het
C1qc A G 4: 136,890,357 S143P possibly damaging Het
Crim1 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 78,200,833 probably benign Het
Defa22 G T 8: 21,162,368 V17F probably damaging Het
Fer1l4 T A 2: 156,046,249 T439S possibly damaging Het
Flt3 A G 5: 147,356,860 S469P probably benign Het
Krtap19-9b A T 16: 88,932,052 S54T unknown Het
Ncor1 T C 11: 62,334,040 D798G probably damaging Het
Olfr1155 A T 2: 87,943,533 L32M probably benign Het
Oosp1 T C 19: 11,667,799 H167R possibly damaging Het
Poln A T 5: 34,133,109 probably null Het
Primpol A T 8: 46,593,699 N187K probably damaging Het
Prr12 A G 7: 45,050,253 probably benign Het
Setd1b A G 5: 123,147,841 T317A unknown Het
Sgo2b G A 8: 63,928,421 T459M probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zfp455 C T 13: 67,206,964 R99* probably null Het
Other mutations in Brix1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03136:Brix1 APN 15 10478766 missense probably damaging 0.97
R4276:Brix1 UTSW 15 10481747 missense possibly damaging 0.60
R4320:Brix1 UTSW 15 10483312 missense probably damaging 1.00
R4824:Brix1 UTSW 15 10485742 missense possibly damaging 0.90
R4902:Brix1 UTSW 15 10483292 splice site probably null
R6018:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6019:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6021:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6022:Brix1 UTSW 15 10476589 missense probably benign 0.26
R7203:Brix1 UTSW 15 10483292 splice site probably null
R7218:Brix1 UTSW 15 10483292 splice site probably null
X0023:Brix1 UTSW 15 10478686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTGTGGCAGCAATCACTTG -3'
(R):5'- GGAAACTGTTTGAAAGGTTCTCGGC -3'

Sequencing Primer
(F):5'- CTTGCCACAAATATCAGAAGGAG -3'
(R):5'- ATAGGCTTTTGATGACTTGCCAC -3'
Posted On2014-01-29