Incidental Mutation 'R1268:Fmo6'
ID151198
Institutional Source Beutler Lab
Gene Symbol Fmo6
Ensembl Gene ENSMUSG00000095576
Gene Nameflavin containing monooxygenase 6
Synonyms
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162916551-162937515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162920517 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 326 (I326N)
Ref Sequence ENSEMBL: ENSMUSP00000136378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178465] [ENSMUST00000195576]
Predicted Effect probably damaging
Transcript: ENSMUST00000178465
AA Change: I326N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136378
Gene: ENSMUSG00000095576
AA Change: I326N

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 3.2e-273 PFAM
Pfam:Pyr_redox_2 3 226 2e-13 PFAM
Pfam:Pyr_redox_3 6 220 4.6e-17 PFAM
Pfam:K_oxygenase 79 223 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195576
SMART Domains Protein: ENSMUSP00000144106
Gene: ENSMUSG00000095576

DomainStartEndE-ValueType
Pfam:FMO-like 2 118 5.1e-58 PFAM
Pfam:NAD_binding_8 7 84 2.2e-5 PFAM
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Fmo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Fmo6 APN 1 162930011 nonsense probably null
IGL02083:Fmo6 APN 1 162920464 nonsense probably null
adventure UTSW 1 162922810 missense probably benign
R0792:Fmo6 UTSW 1 162920563 missense probably damaging 0.98
R0940:Fmo6 UTSW 1 162926226 missense probably benign 0.07
R1173:Fmo6 UTSW 1 162926141 missense probably damaging 1.00
R1538:Fmo6 UTSW 1 162926106 missense probably damaging 1.00
R1694:Fmo6 UTSW 1 162922672 missense probably benign
R1717:Fmo6 UTSW 1 162926252 nonsense probably null
R1837:Fmo6 UTSW 1 162922810 missense probably benign
R2125:Fmo6 UTSW 1 162929958 missense possibly damaging 0.82
R2434:Fmo6 UTSW 1 162916870 missense probably benign 0.00
R2894:Fmo6 UTSW 1 162922724 nonsense probably null
R4864:Fmo6 UTSW 1 162924395 missense probably benign 0.34
R6414:Fmo6 UTSW 1 162920445 missense probably damaging 0.97
R6576:Fmo6 UTSW 1 162922695 missense probably damaging 1.00
R6883:Fmo6 UTSW 1 162929892 missense probably damaging 1.00
R7013:Fmo6 UTSW 1 162918248 missense probably benign 0.00
X0025:Fmo6 UTSW 1 162920496 missense probably benign 0.29
X0025:Fmo6 UTSW 1 162922858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTTTAGCAGCCCAGCGTG -3'
(R):5'- TCTACTTGGTGAGTCTCCGAAGACC -3'

Sequencing Primer
(F):5'- CGTGCCTGGAGGTCAGC -3'
(R):5'- GAATTTCTGCCTGAGAAGCAC -3'
Posted On2014-01-29