Incidental Mutation 'R1268:Myh7b'
ID151203
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 155614046 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 117 (S117*)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
Predicted Effect probably null
Transcript: ENSMUST00000092995
AA Change: S117*
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: S117*

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
irrational UTSW 2 155630672 unclassified probably benign
muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTGCAGCTCAGGCTGGAAC -3'
(R):5'- ACGTCCAGTGAGTGAGACCAAGTAG -3'

Sequencing Primer
(F):5'- GCTCAGGCTGGAACAGAAG -3'
(R):5'- TGAGACCAAGTAGGATTTCCAAAC -3'
Posted On2014-01-29