Incidental Mutation 'R1268:Samd9l'
ID151209
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Namesterile alpha motif domain containing 9-like
SynonymsESTM25
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3372257-3399572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3376113 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 383 (V383I)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120087
AA Change: V383I

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: V383I

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3376779 missense probably damaging 0.96
IGL00550:Samd9l APN 6 3374594 missense probably benign 0.00
IGL01100:Samd9l APN 6 3375863 missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3376259 missense probably benign 0.42
IGL01553:Samd9l APN 6 3375566 missense probably damaging 0.99
IGL01575:Samd9l APN 6 3376734 missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3375120 missense probably benign 0.02
IGL01915:Samd9l APN 6 3373864 nonsense probably null
IGL02063:Samd9l APN 6 3372992 missense probably damaging 1.00
IGL02066:Samd9l APN 6 3376575 missense probably damaging 1.00
IGL02145:Samd9l APN 6 3374105 missense probably benign 0.13
IGL02163:Samd9l APN 6 3374246 missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3376197 missense probably damaging 1.00
IGL02508:Samd9l APN 6 3374798 missense probably damaging 1.00
IGL02591:Samd9l APN 6 3375760 missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3376026 missense probably damaging 1.00
IGL03058:Samd9l APN 6 3374980 missense probably damaging 0.99
IGL03068:Samd9l APN 6 3375348 nonsense probably null
IGL03160:Samd9l APN 6 3374894 missense probably damaging 1.00
IGL03372:Samd9l APN 6 3375314 missense probably damaging 1.00
IGL03385:Samd9l APN 6 3376208 missense probably damaging 0.99
boston_lager UTSW 6 3375761 missense probably benign 0.12
ipa UTSW 6 3376347 missense probably damaging 1.00
IGL03054:Samd9l UTSW 6 3376023 missense probably damaging 1.00
R0111:Samd9l UTSW 6 3374946 missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3376031 missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3377264 start gained probably benign
R0398:Samd9l UTSW 6 3374502 missense probably damaging 1.00
R0744:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3377064 missense probably damaging 1.00
R1110:Samd9l UTSW 6 3374267 missense probably benign 0.44
R1155:Samd9l UTSW 6 3376939 missense probably benign 0.01
R1293:Samd9l UTSW 6 3373947 missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3376369 missense probably benign 0.06
R1573:Samd9l UTSW 6 3375426 missense probably damaging 0.99
R1590:Samd9l UTSW 6 3375761 missense probably benign 0.12
R1611:Samd9l UTSW 6 3373771 missense probably benign 0.00
R1754:Samd9l UTSW 6 3373126 missense probably damaging 0.96
R1759:Samd9l UTSW 6 3373401 missense probably damaging 1.00
R1795:Samd9l UTSW 6 3375264 nonsense probably null
R1829:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3376269 missense probably benign 0.01
R2154:Samd9l UTSW 6 3372945 missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3376910 missense probably benign 0.08
R3622:Samd9l UTSW 6 3374032 nonsense probably null
R3903:Samd9l UTSW 6 3376830 nonsense probably null
R3904:Samd9l UTSW 6 3376830 nonsense probably null
R3945:Samd9l UTSW 6 3377029 missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3376887 missense probably benign 0.22
R4602:Samd9l UTSW 6 3373935 missense probably damaging 1.00
R4602:Samd9l UTSW 6 3373937 frame shift probably null
R4618:Samd9l UTSW 6 3376347 missense probably damaging 1.00
R4747:Samd9l UTSW 6 3375504 nonsense probably null
R4762:Samd9l UTSW 6 3375623 missense probably benign 0.01
R4814:Samd9l UTSW 6 3372863 missense probably damaging 0.98
R4934:Samd9l UTSW 6 3375621 nonsense probably null
R5026:Samd9l UTSW 6 3375284 missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3374157 missense probably benign 0.35
R5130:Samd9l UTSW 6 3374548 missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3376156 missense probably benign 0.02
R5328:Samd9l UTSW 6 3376739 missense probably damaging 0.99
R5507:Samd9l UTSW 6 3373898 missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3373291 missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3376754 missense probably benign
R5881:Samd9l UTSW 6 3372716 missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3376460 missense probably damaging 1.00
R6131:Samd9l UTSW 6 3377252 missense probably benign 0.00
R6199:Samd9l UTSW 6 3376686 missense probably benign 0.13
R6298:Samd9l UTSW 6 3375383 missense probably damaging 1.00
R6331:Samd9l UTSW 6 3376361 missense probably damaging 1.00
R6489:Samd9l UTSW 6 3376896 missense probably benign
R6601:Samd9l UTSW 6 3377229 missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3377247 missense probably benign 0.22
R6803:Samd9l UTSW 6 3375446 missense probably damaging 0.97
R6864:Samd9l UTSW 6 3374750 missense probably benign 0.14
R6905:Samd9l UTSW 6 3375387 missense probably damaging 0.99
R6919:Samd9l UTSW 6 3376313 missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3372716 missense probably damaging 0.99
R7073:Samd9l UTSW 6 3375856 nonsense probably null
R7250:Samd9l UTSW 6 3374201 missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3372600 nonsense probably null
R7351:Samd9l UTSW 6 3374157 missense probably benign 0.35
X0026:Samd9l UTSW 6 3375560 missense probably damaging 1.00
X0066:Samd9l UTSW 6 3374477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCATAGTGACTGGGCAGGTG -3'
(R):5'- AATCAGTGAAGCCAGGGCTTGTATC -3'

Sequencing Primer
(F):5'- CCACTCCCTTGATGTGAGAATAAG -3'
(R):5'- TGAGGTAGATGTTATTCCCAGAC -3'
Posted On2014-01-29