Incidental Mutation 'R1268:Gnat1'
ID 151214
Institutional Source Beutler Lab
Gene Symbol Gnat1
Ensembl Gene ENSMUSG00000034837
Gene Name G protein subunit alpha transducin 1
Synonyms transducin, Gnat-1, Tralpha, irdr, Ird2, Ird1
MMRRC Submission 039335-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R1268 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107551636-107556833 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 107553076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010205] [ENSMUST00000192271]
AlphaFold P20612
Predicted Effect probably benign
Transcript: ENSMUST00000010205
SMART Domains Protein: ENSMUSP00000010205
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
G_alpha 9 349 5.13e-223 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192271
SMART Domains Protein: ENSMUSP00000141571
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195849
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in rods. This gene is also expressed in other cells, and has been implicated in bitter taste transduction in rat taste cells. Mutations in this gene result in autosomal dominant congenital stationary night blindness. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruption of this gene display retinal degeneration with age and abnormal electrophysiology of the rods. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 14,108,248 (GRCm39) V1257A probably damaging Het
Aplnr A G 2: 84,967,775 (GRCm39) T267A possibly damaging Het
Arap2 A G 5: 62,887,964 (GRCm39) S461P probably benign Het
Brpf3 A G 17: 29,055,530 (GRCm39) T1160A probably damaging Het
Col5a1 A T 2: 27,892,501 (GRCm39) T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,958,570 (GRCm39) probably null Het
Fmo6 A T 1: 162,748,086 (GRCm39) I326N probably damaging Het
Foxp4 G C 17: 48,191,278 (GRCm39) probably benign Het
Hs6st1 T A 1: 36,108,007 (GRCm39) V90D probably damaging Het
Igsf11 A G 16: 38,845,216 (GRCm39) T257A probably benign Het
Ints2 C T 11: 86,123,911 (GRCm39) G626R probably damaging Het
Mab21l3 C T 3: 101,742,363 (GRCm39) E66K possibly damaging Het
Mroh2a C T 1: 88,158,402 (GRCm39) R150* probably null Het
Mybl2 A G 2: 162,916,636 (GRCm39) N429S probably benign Het
Mycbp2 G A 14: 103,446,218 (GRCm39) T1837I probably damaging Het
Myh7b C A 2: 155,455,966 (GRCm39) S117* probably null Het
Nek1 C A 8: 61,475,298 (GRCm39) A202E probably damaging Het
Notum C T 11: 120,549,493 (GRCm39) W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,103,959 (GRCm39) probably benign Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or2w2 C T 13: 21,758,498 (GRCm39) V43M probably benign Het
Or4c58 A G 2: 89,674,498 (GRCm39) I273T probably damaging Het
Or4f57 G T 2: 111,791,222 (GRCm39) N65K possibly damaging Het
Or5b99 T C 19: 12,976,625 (GRCm39) Y92H possibly damaging Het
Or5p69 A T 7: 107,967,002 (GRCm39) I102F probably benign Het
Or7g12 T C 9: 18,899,652 (GRCm39) F123L probably damaging Het
Plk4 T A 3: 40,765,804 (GRCm39) V659D probably damaging Het
Rbm27 T C 18: 42,466,367 (GRCm39) S866P probably damaging Het
Rnaseh2b A T 14: 62,609,904 (GRCm39) K303N possibly damaging Het
Samd9l C T 6: 3,376,113 (GRCm39) V383I possibly damaging Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Slc35f2 T A 9: 53,705,197 (GRCm39) Y62* probably null Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Ulk1 A G 5: 110,938,143 (GRCm39) S610P probably damaging Het
Ulk4 C A 9: 121,086,140 (GRCm39) probably benign Het
Vdr T C 15: 97,755,356 (GRCm39) N389S probably benign Het
Other mutations in Gnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Gnat1 APN 9 107,556,633 (GRCm39) splice site probably null
IGL01514:Gnat1 APN 9 107,553,500 (GRCm39) missense possibly damaging 0.56
R0730:Gnat1 UTSW 9 107,556,662 (GRCm39) missense probably damaging 1.00
R1054:Gnat1 UTSW 9 107,554,638 (GRCm39) missense probably damaging 1.00
R1440:Gnat1 UTSW 9 107,554,164 (GRCm39) missense probably damaging 1.00
R1824:Gnat1 UTSW 9 107,553,774 (GRCm39) missense probably damaging 1.00
R4964:Gnat1 UTSW 9 107,554,433 (GRCm39) missense probably benign 0.05
R4966:Gnat1 UTSW 9 107,554,433 (GRCm39) missense probably benign 0.05
R6355:Gnat1 UTSW 9 107,554,623 (GRCm39) missense probably benign 0.03
R7035:Gnat1 UTSW 9 107,553,827 (GRCm39) unclassified probably benign
R7218:Gnat1 UTSW 9 107,553,184 (GRCm39) missense possibly damaging 0.85
R9439:Gnat1 UTSW 9 107,553,511 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTTGAGGGGACTACAGGGCTACAG -3'
(R):5'- GACCTAACACTTACGAGGATGCCG -3'

Sequencing Primer
(F):5'- cagggctacagggctgc -3'
(R):5'- GGCAACTACATCAAAGTGCAG -3'
Posted On 2014-01-29