Incidental Mutation 'R1269:Inpp4a'
ID151232
Institutional Source Beutler Lab
Gene Symbol Inpp4a
Ensembl Gene ENSMUSG00000026113
Gene Nameinositol polyphosphate-4-phosphatase, type I
Synonyms107kDa
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R1269 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location37299865-37410736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37389742 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 83 (S83P)
Ref Sequence ENSEMBL: ENSMUSP00000142118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027287] [ENSMUST00000058307] [ENSMUST00000114933] [ENSMUST00000132401] [ENSMUST00000132615] [ENSMUST00000136846] [ENSMUST00000137266] [ENSMUST00000140264] [ENSMUST00000168546] [ENSMUST00000193774]
Predicted Effect probably benign
Transcript: ENSMUST00000027287
AA Change: S716P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027287
Gene: ENSMUSG00000026113
AA Change: S716P

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058307
AA Change: S440P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000057233
Gene: ENSMUSG00000026113
AA Change: S440P

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114933
AA Change: S451P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110583
Gene: ENSMUSG00000026113
AA Change: S451P

DomainStartEndE-ValueType
low complexity region 300 325 N/A INTRINSIC
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132401
AA Change: S749P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123071
Gene: ENSMUSG00000026113
AA Change: S749P

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 602 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132615
AA Change: S715P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000115249
Gene: ENSMUSG00000026113
AA Change: S715P

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136846
AA Change: S715P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121518
Gene: ENSMUSG00000026113
AA Change: S715P

DomainStartEndE-ValueType
Blast:C2 49 142 9e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 559 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137266
AA Change: S754P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121803
Gene: ENSMUSG00000026113
AA Change: S754P

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140264
AA Change: S710P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000121107
Gene: ENSMUSG00000026113
AA Change: S710P

DomainStartEndE-ValueType
Blast:C2 49 142 7e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 564 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168546
AA Change: S440P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130443
Gene: ENSMUSG00000026113
AA Change: S440P

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193774
AA Change: S83P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142118
Gene: ENSMUSG00000026113
AA Change: S83P

DomainStartEndE-ValueType
Blast:C2 45 87 7e-13 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit small size, ataxia, loss of cerebellar and hippocampal CA1 neurons, and death by 24 days of age from seizures and/or malnutrition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in Inpp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Inpp4a APN 1 37388905 missense probably damaging 1.00
IGL01821:Inpp4a APN 1 37377717 missense probably damaging 1.00
IGL02015:Inpp4a APN 1 37389712 missense probably damaging 1.00
IGL02036:Inpp4a APN 1 37377569 intron probably benign
IGL02040:Inpp4a APN 1 37396085 missense probably damaging 0.99
IGL02082:Inpp4a APN 1 37366627 intron probably benign
IGL02318:Inpp4a APN 1 37368303 missense probably damaging 1.00
IGL02555:Inpp4a APN 1 37379968 missense possibly damaging 0.70
IGL02622:Inpp4a APN 1 37379034 missense probably benign 0.26
R0265:Inpp4a UTSW 1 37378986 missense probably damaging 1.00
R0388:Inpp4a UTSW 1 37396160 missense probably damaging 0.96
R0543:Inpp4a UTSW 1 37369492 intron probably benign
R1719:Inpp4a UTSW 1 37398799 missense probably damaging 1.00
R1799:Inpp4a UTSW 1 37392978 missense possibly damaging 0.56
R2127:Inpp4a UTSW 1 37366919 missense probably benign 0.08
R2143:Inpp4a UTSW 1 37387746 missense probably damaging 1.00
R2174:Inpp4a UTSW 1 37396130 missense probably damaging 1.00
R2258:Inpp4a UTSW 1 37377696 missense probably damaging 1.00
R2327:Inpp4a UTSW 1 37366166 missense probably damaging 0.96
R2437:Inpp4a UTSW 1 37392956 missense probably damaging 1.00
R2897:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R2898:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R4830:Inpp4a UTSW 1 37371780 missense probably damaging 1.00
R4934:Inpp4a UTSW 1 37387841 missense possibly damaging 0.74
R5141:Inpp4a UTSW 1 37380087 missense probably benign 0.17
R5152:Inpp4a UTSW 1 37358535 missense possibly damaging 0.88
R5627:Inpp4a UTSW 1 37367773 missense probably damaging 0.96
R5789:Inpp4a UTSW 1 37372329 missense possibly damaging 0.75
R6004:Inpp4a UTSW 1 37372370 missense probably damaging 0.99
R6107:Inpp4a UTSW 1 37377748 missense probably damaging 0.98
R6180:Inpp4a UTSW 1 37380102 missense probably benign
R6434:Inpp4a UTSW 1 37398838 missense probably damaging 1.00
R6571:Inpp4a UTSW 1 37387758 missense probably damaging 1.00
R6766:Inpp4a UTSW 1 37372341 missense probably damaging 1.00
R6992:Inpp4a UTSW 1 37389691 missense probably damaging 0.98
R7025:Inpp4a UTSW 1 37369423 missense probably benign 0.00
R7126:Inpp4a UTSW 1 37374272 missense probably benign 0.00
R7473:Inpp4a UTSW 1 37369453 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ATGGGTTCTTGAAGAGGCACCCAC -3'
(R):5'- GGGTCTGGGAAGGCTATATGCAATG -3'

Sequencing Primer
(F):5'- CTATGCAGAGTCTGTCTCAGAGAAC -3'
(R):5'- GGCTATATGCAATGCTCTAAAGG -3'
Posted On2014-01-29