Incidental Mutation 'R1269:Epc2'
ID151234
Institutional Source Beutler Lab
Gene Symbol Epc2
Ensembl Gene ENSMUSG00000069495
Gene Nameenhancer of polycomb homolog 2
SynonymsD2Ertd694e
Accession Numbers

Ncbi RefSeq: NM_172663.4; MGI:1278321

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1269 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location49451486-49551948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49522576 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 189 (S189T)
Ref Sequence ENSEMBL: ENSMUSP00000089758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092123]
Predicted Effect probably benign
Transcript: ENSMUST00000092123
AA Change: S189T

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089758
Gene: ENSMUSG00000069495
AA Change: S189T

DomainStartEndE-ValueType
Pfam:EPL1 7 149 6.5e-18 PFAM
low complexity region 334 342 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:E_Pc_C 578 808 2.1e-70 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI

All alleles(45) : Targeted(3) Gene trapped(42)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in Epc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Epc2 APN 2 49532197 missense probably damaging 1.00
IGL02479:Epc2 APN 2 49532135 missense probably benign 0.00
IGL03342:Epc2 APN 2 49536646 missense probably benign 0.02
IGL02984:Epc2 UTSW 2 49528854 missense probably damaging 1.00
R0014:Epc2 UTSW 2 49522525 nonsense probably null
R0014:Epc2 UTSW 2 49522525 nonsense probably null
R0360:Epc2 UTSW 2 49537133 missense possibly damaging 0.81
R0364:Epc2 UTSW 2 49537133 missense possibly damaging 0.81
R0401:Epc2 UTSW 2 49528974 missense probably damaging 0.99
R1495:Epc2 UTSW 2 49536663 missense probably damaging 1.00
R1573:Epc2 UTSW 2 49549972 missense possibly damaging 0.81
R1619:Epc2 UTSW 2 49549978 missense probably damaging 0.99
R1721:Epc2 UTSW 2 49532105 missense probably damaging 1.00
R1847:Epc2 UTSW 2 49532089 missense probably damaging 1.00
R1867:Epc2 UTSW 2 49532105 missense probably damaging 1.00
R2113:Epc2 UTSW 2 49532223 missense probably benign
R2120:Epc2 UTSW 2 49547609 splice site probably benign
R3840:Epc2 UTSW 2 49488738 missense probably damaging 1.00
R3841:Epc2 UTSW 2 49488738 missense probably damaging 1.00
R4366:Epc2 UTSW 2 49547554 missense possibly damaging 0.84
R4864:Epc2 UTSW 2 49537165 missense probably benign
R5335:Epc2 UTSW 2 49513230 missense probably benign 0.39
R5639:Epc2 UTSW 2 49451891 missense possibly damaging 0.78
R5695:Epc2 UTSW 2 49547607 critical splice donor site probably null
R6259:Epc2 UTSW 2 49488854 splice site probably null
R6420:Epc2 UTSW 2 49451900 missense probably damaging 0.98
R6667:Epc2 UTSW 2 49522669 missense probably damaging 0.99
R6788:Epc2 UTSW 2 49532087 missense probably benign 0.32
R7061:Epc2 UTSW 2 49535322 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATAGACTTCCATCTTCACCTGCCG -3'
(R):5'- TGATCAGACTGCTACAGCAGGCTATAC -3'

Sequencing Primer
(F):5'- CAGTGGATCACATTTTCTGCG -3'
(R):5'- ATCAGGTTAGGTCATCAGTGTCAC -3'
Posted On2014-01-29