Incidental Mutation 'R1269:Nlrp4e'
ID151244
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene NameNLR family, pyrin domain containing 4E
Synonyms4930406H16Rik, Nalp4e, Nalp-epsilon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1269 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23301192-23362277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23353338 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 894 (I894N)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076470
AA Change: I894N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: I894N

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208495
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCGTACTTTTCAGATCAGGGAATAACCA -3'
(R):5'- CCCATATTACGGTCCCCTAGATGATCAA -3'

Sequencing Primer
(F):5'- AACCAGAACCTGAGGAACCT -3'
(R):5'- tgaaccatcacaacagccc -3'
Posted On2014-01-29