Incidental Mutation 'R1269:Pstpip1'
ID151249
Institutional Source Beutler Lab
Gene Symbol Pstpip1
Ensembl Gene ENSMUSG00000032322
Gene Nameproline-serine-threonine phosphatase-interacting protein 1
Synonymsdef-2, CD2BP1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1269 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location56089962-56128888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56114306 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 38 (D38G)
Ref Sequence ENSEMBL: ENSMUSP00000055823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059206]
Predicted Effect probably damaging
Transcript: ENSMUST00000059206
AA Change: D38G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055823
Gene: ENSMUSG00000032322
AA Change: D38G

DomainStartEndE-ValueType
FCH 12 98 7.03e-29 SMART
Blast:SH3 226 248 1e-7 BLAST
low complexity region 318 337 N/A INTRINSIC
SH3 361 415 8.24e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147360
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is highly expressed in hemopoietic tissues. This protein functions via its interaction with several different proteins involved in cytoskeletal organization and inflammatory processes. It binds to the cytoplasmic tail of CD2, an effector of T cell activation and adhesion, downregulating CD2-triggered adhesion. It binds PEST-type protein tyrosine phosphatases (PTP) and directs them to c-Abl kinase to mediate c-Abl dephosphorylation, thereby, regulating c-Abl activity. It also interacts with pyrin, which is found in association with the cytoskeleton in myeloid/monocytic cells and modulates immunoregulatory functions. Mutations in this gene are associated with PAPA (pyogenic sterile arthritis, pyoderma gangrenosum, and acne) syndrome. It is hypothesized that the disease-causing mutations compromise physiologic signaling necessary for the maintenance of a proper inflammatory response. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in immune cells with T cell hyperresponsive to antigen receptor stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in Pstpip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03103:Pstpip1 APN 9 56114308 missense possibly damaging 0.65
R0108:Pstpip1 UTSW 9 56127766 missense probably benign 0.00
R0344:Pstpip1 UTSW 9 56126645 missense probably benign
R1743:Pstpip1 UTSW 9 56125930 missense probably damaging 1.00
R4648:Pstpip1 UTSW 9 56125218 missense probably damaging 1.00
R4778:Pstpip1 UTSW 9 56128620 missense possibly damaging 0.95
R5932:Pstpip1 UTSW 9 56125930 missense probably damaging 1.00
R7107:Pstpip1 UTSW 9 56128650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGTCATAAGGGCATGAGCAACG -3'
(R):5'- CCATGAGCTTCTGTGGATTCTCCTG -3'

Sequencing Primer
(F):5'- AGGCAGGCATTCCACGAG -3'
(R):5'- cttgctatagaaggggatttgaac -3'
Posted On2014-01-29