Incidental Mutation 'R1269:Wfikkn2'
ID151254
Institutional Source Beutler Lab
Gene Symbol Wfikkn2
Ensembl Gene ENSMUSG00000044177
Gene NameWAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Synonyms2610304F08Rik, Gasp1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1269 (G1)
Quality Score195
Status Not validated
Chromosome11
Chromosomal Location94235956-94246005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94238475 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 280 (Y280C)
Ref Sequence ENSEMBL: ENSMUSP00000053238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061469]
Predicted Effect probably damaging
Transcript: ENSMUST00000061469
AA Change: Y280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053238
Gene: ENSMUSG00000044177
AA Change: Y280C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WAP 37 87 1.77e-3 SMART
low complexity region 91 102 N/A INTRINSIC
KAZAL 128 170 1.5e-2 SMART
low complexity region 179 192 N/A INTRINSIC
IGc2 217 289 1.3e-11 SMART
KU 321 374 2e-14 SMART
KU 379 432 2.79e-27 SMART
Pfam:NTR 451 556 2.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131352
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WFIKKN1 protein contains a WAP domain, follistatin domain, immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. This gene encodes a WFIKKN1-related protein which has the same domain organization as the WFIKKN1 protein. The WAP-type, follistatin type, Kunitz-type, and NTR-type protease inhibitory domains may control the action of multiple types of proteases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in Wfikkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Wfikkn2 APN 11 94238095 nonsense probably null
R1466:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1519:Wfikkn2 UTSW 11 94238107 missense probably benign 0.00
R1584:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1856:Wfikkn2 UTSW 11 94238123 nonsense probably null
R2026:Wfikkn2 UTSW 11 94238953 missense possibly damaging 0.93
R2842:Wfikkn2 UTSW 11 94238259 missense probably benign 0.00
R4738:Wfikkn2 UTSW 11 94239076 missense probably benign 0.00
R4833:Wfikkn2 UTSW 11 94239052 missense probably benign 0.09
R5087:Wfikkn2 UTSW 11 94238347 missense probably damaging 1.00
R5775:Wfikkn2 UTSW 11 94238288 missense probably benign 0.22
R5966:Wfikkn2 UTSW 11 94238862 missense probably damaging 1.00
R6842:Wfikkn2 UTSW 11 94238040 missense probably damaging 0.96
R7539:Wfikkn2 UTSW 11 94242359 missense probably damaging 1.00
R7544:Wfikkn2 UTSW 11 94237912 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAAAGTTGTTACCGTTGCCCTCAC -3'
(R):5'- ACCATCCTGTCCATCAGTCAGTCAC -3'

Sequencing Primer
(F):5'- GCCTCGTAGGTCTCAAAGTG -3'
(R):5'- ATCAGTCAGTCACCGTGGG -3'
Posted On2014-01-29