Incidental Mutation 'R1271:Des'
ID151295
Institutional Source Beutler Lab
Gene Symbol Des
Ensembl Gene ENSMUSG00000026208
Gene Namedesmin
Synonyms
MMRRC Submission 039337-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R1271 (G1)
Quality Score109
Status Not validated
Chromosome1
Chromosomal Location75360329-75368579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75360646 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 77 (T77S)
Ref Sequence ENSEMBL: ENSMUSP00000027409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027409]
Predicted Effect probably benign
Transcript: ENSMUST00000027409
AA Change: T77S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027409
Gene: ENSMUSG00000026208
AA Change: T77S

DomainStartEndE-ValueType
Pfam:Filament_head 9 105 1.3e-25 PFAM
Filament 106 414 7.41e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144894
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane and are essential for maintaining the strength and integrity of skeletal, cardiac and smooth muscle fibers. Mutations in this gene affect assembly of intermediate filaments. Mice lacking this gene are able to develop and reproduce but exhibit abnormal muscle fibers. Mutations in the human gene are associated with myofibrillar myopathy, dilated cardiomyopathy, neurogenic scapuloperoneal syndrome and autosomal recessive limb-girdle muscular dystrophy, type 2R. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit histologically detectable defects of cardiac, skeletal, and smooth muscle. Defects in the heart are most severe, and lead to calcification, progressive degeneration, and necrosis of the myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik A T 1: 52,925,334 D78E possibly damaging Het
4930447C04Rik A T 12: 72,892,883 F419I possibly damaging Het
Abca14 T C 7: 120,325,117 V1664A probably damaging Het
Acadvl A G 11: 70,014,700 S71P probably damaging Het
Adcy2 A T 13: 68,642,498 C916S probably damaging Het
Atad2 T C 15: 58,126,589 T164A probably benign Het
Ccdc18 A T 5: 108,202,116 K1045* probably null Het
Cfap43 C T 19: 47,739,744 E1525K probably benign Het
Cfap43 G T 19: 47,747,948 S1368Y probably damaging Het
Csmd3 T A 15: 48,011,059 I610L probably benign Het
Fnip1 T C 11: 54,503,297 V853A probably benign Het
Gabrg1 T A 5: 70,777,144 D292V probably damaging Het
Gcm1 A G 9: 78,059,577 N26S probably benign Het
Gpsm1 G T 2: 26,344,672 R507L probably damaging Het
H2-M1 T A 17: 36,671,245 T155S probably benign Het
Hapln3 T C 7: 79,118,016 D210G probably damaging Het
Magel2 T C 7: 62,381,014 L1222P unknown Het
Mphosph10 A T 7: 64,390,084 probably null Het
Mup6 A T 4: 60,003,579 probably benign Het
Nsmce1 T A 7: 125,471,254 E128D probably damaging Het
Olfr1206 T A 2: 88,865,131 Y175* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sorbs2 T A 8: 45,795,967 S733T probably damaging Het
Stxbp5 A T 10: 9,816,269 I377K probably damaging Het
Tmem2 T A 19: 21,823,904 I795N possibly damaging Het
Tnfsf4 T A 1: 161,395,703 L41Q probably damaging Het
Usp28 G A 9: 49,035,961 probably null Het
Zcchc6 A C 13: 59,821,855 N75K probably damaging Het
Other mutations in Des
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Des APN 1 75362583 missense probably benign 0.02
IGL02416:Des APN 1 75362728 critical splice donor site probably null
IGL02953:Des APN 1 75363644 missense possibly damaging 0.95
IGL03156:Des APN 1 75362996 missense probably damaging 1.00
IGL03288:Des APN 1 75362341 missense possibly damaging 0.79
R0032:Des UTSW 1 75362166 missense possibly damaging 0.87
R0849:Des UTSW 1 75360628 missense probably benign
R0885:Des UTSW 1 75360730 missense probably damaging 1.00
R1452:Des UTSW 1 75363477 missense probably damaging 1.00
R1559:Des UTSW 1 75360586 missense probably benign 0.11
R1929:Des UTSW 1 75363493 missense probably damaging 0.99
R2144:Des UTSW 1 75366804 missense probably benign 0.45
R2145:Des UTSW 1 75363464 splice site probably benign
R2271:Des UTSW 1 75363493 missense probably damaging 0.99
R4182:Des UTSW 1 75362584 missense probably benign 0.00
R4184:Des UTSW 1 75362584 missense probably benign 0.00
R4383:Des UTSW 1 75360769 missense possibly damaging 0.94
R5268:Des UTSW 1 75362928 missense possibly damaging 0.50
R5787:Des UTSW 1 75363646 missense probably damaging 0.98
R5974:Des UTSW 1 75362984 missense probably benign 0.10
R6044:Des UTSW 1 75363469 critical splice acceptor site probably null
R6985:Des UTSW 1 75366787 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCAGCTCCTTGCCCTGTGAAAC -3'
(R):5'- AAGAAGCGCACCTTCTCGATGTAG -3'

Sequencing Primer
(F):5'- CTTTTCCTGGCAGGACAGAG -3'
(R):5'- CTCGATGTAGTTGGCGAAGC -3'
Posted On2014-01-29