Incidental Mutation 'R1271:Gabrg1'
ID151303
Institutional Source Beutler Lab
Gene Symbol Gabrg1
Ensembl Gene ENSMUSG00000001260
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 1
SynonymsGabaA
MMRRC Submission 039337-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1271 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location70751047-70842617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70777144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 292 (D292V)
Ref Sequence ENSEMBL: ENSMUSP00000142454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031119] [ENSMUST00000199705]
Predicted Effect probably damaging
Transcript: ENSMUST00000031119
AA Change: D297V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031119
Gene: ENSMUSG00000001260
AA Change: D297V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 40 46 N/A INTRINSIC
Pfam:Neur_chan_LBD 64 270 7e-51 PFAM
Pfam:Neur_chan_memb 277 378 2.3e-36 PFAM
low complexity region 411 422 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197068
Predicted Effect probably damaging
Transcript: ENSMUST00000199705
AA Change: D292V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142454
Gene: ENSMUSG00000001260
AA Change: D292V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 35 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 265 1.7e-50 PFAM
Pfam:Neur_chan_memb 272 304 9.5e-12 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 395 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik A T 1: 52,925,334 D78E possibly damaging Het
4930447C04Rik A T 12: 72,892,883 F419I possibly damaging Het
Abca14 T C 7: 120,325,117 V1664A probably damaging Het
Acadvl A G 11: 70,014,700 S71P probably damaging Het
Adcy2 A T 13: 68,642,498 C916S probably damaging Het
Atad2 T C 15: 58,126,589 T164A probably benign Het
Ccdc18 A T 5: 108,202,116 K1045* probably null Het
Cfap43 C T 19: 47,739,744 E1525K probably benign Het
Cfap43 G T 19: 47,747,948 S1368Y probably damaging Het
Csmd3 T A 15: 48,011,059 I610L probably benign Het
Des A T 1: 75,360,646 T77S probably benign Het
Fnip1 T C 11: 54,503,297 V853A probably benign Het
Gcm1 A G 9: 78,059,577 N26S probably benign Het
Gpsm1 G T 2: 26,344,672 R507L probably damaging Het
H2-M1 T A 17: 36,671,245 T155S probably benign Het
Hapln3 T C 7: 79,118,016 D210G probably damaging Het
Magel2 T C 7: 62,381,014 L1222P unknown Het
Mphosph10 A T 7: 64,390,084 probably null Het
Mup6 A T 4: 60,003,579 probably benign Het
Nsmce1 T A 7: 125,471,254 E128D probably damaging Het
Olfr1206 T A 2: 88,865,131 Y175* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sorbs2 T A 8: 45,795,967 S733T probably damaging Het
Stxbp5 A T 10: 9,816,269 I377K probably damaging Het
Tmem2 T A 19: 21,823,904 I795N possibly damaging Het
Tnfsf4 T A 1: 161,395,703 L41Q probably damaging Het
Usp28 G A 9: 49,035,961 probably null Het
Zcchc6 A C 13: 59,821,855 N75K probably damaging Het
Other mutations in Gabrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Gabrg1 APN 5 70815955 critical splice donor site probably null
IGL00798:Gabrg1 APN 5 70782283 missense probably damaging 1.00
IGL01012:Gabrg1 APN 5 70778169 missense probably benign 0.03
IGL01597:Gabrg1 APN 5 70782348 missense probably damaging 1.00
IGL01637:Gabrg1 APN 5 70777205 missense probably damaging 1.00
IGL02589:Gabrg1 APN 5 70842152 nonsense probably null
IGL03031:Gabrg1 APN 5 70794682 nonsense probably null
IGL03346:Gabrg1 APN 5 70778131 missense possibly damaging 0.89
PIT4260001:Gabrg1 UTSW 5 70782280 missense probably benign 0.01
R0197:Gabrg1 UTSW 5 70774389 missense probably damaging 1.00
R1795:Gabrg1 UTSW 5 70782253 missense possibly damaging 0.83
R1817:Gabrg1 UTSW 5 70754251 missense probably benign 0.08
R1820:Gabrg1 UTSW 5 70774413 missense probably damaging 1.00
R2254:Gabrg1 UTSW 5 70782364 nonsense probably null
R4566:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R4768:Gabrg1 UTSW 5 70754173 missense probably damaging 0.99
R4976:Gabrg1 UTSW 5 70774411 missense possibly damaging 0.95
R5104:Gabrg1 UTSW 5 70774432 missense probably damaging 1.00
R6062:Gabrg1 UTSW 5 70780713 missense probably damaging 1.00
R6086:Gabrg1 UTSW 5 70754053 missense probably damaging 1.00
R6148:Gabrg1 UTSW 5 70774461 missense probably damaging 1.00
R6234:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R6724:Gabrg1 UTSW 5 70754209 missense possibly damaging 0.80
R6786:Gabrg1 UTSW 5 70754267 missense probably benign 0.00
R6794:Gabrg1 UTSW 5 70815971 missense probably damaging 1.00
X0027:Gabrg1 UTSW 5 70754261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGGAAGTGTCATGCTCTTTCCA -3'
(R):5'- AAAGCTCAAAGTCTGGTGCAAGTCA -3'

Sequencing Primer
(F):5'- CAAAGTTCTTACAGTAGGGTTTTCTG -3'
(R):5'- GTTAGCAGTAGAGGTCAATGTTAC -3'
Posted On2014-01-29