Incidental Mutation 'R1273:Mkx'
ID151374
Institutional Source Beutler Lab
Gene Symbol Mkx
Ensembl Gene ENSMUSG00000061013
Gene Namemohawk homeobox
Synonyms9430023B20Rik, Irxl1
MMRRC Submission 039339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1273 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location6910459-7004780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 7002460 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 29 (T29P)
Ref Sequence ENSEMBL: ENSMUSP00000078718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079788]
Predicted Effect probably benign
Transcript: ENSMUST00000079788
AA Change: T29P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078718
Gene: ENSMUSG00000061013
AA Change: T29P

DomainStartEndE-ValueType
HOX 71 135 5.01e-4 SMART
low complexity region 158 171 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176757
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an IRX family-related homeobox protein that may play a role in cell adhesion. Studies in mice suggest that this protein may be a regulator of tendon development. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thin, hypoplastic tendons with reduced tensile strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,987,210 F2579S probably damaging Het
Abca5 T C 11: 110,326,665 K122E probably benign Het
Dnah12 C T 14: 26,739,220 Q934* probably null Het
Fsip2 G A 2: 82,989,408 D5162N possibly damaging Het
Lrp6 A G 6: 134,467,507 probably null Het
Nsmce3 A G 7: 64,872,591 Y110H probably benign Het
Olfr901 T C 9: 38,430,684 V134A probably benign Het
Saal1 A T 7: 46,692,942 V359E probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmprss11a T A 5: 86,414,588 R299S probably benign Het
Other mutations in Mkx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mkx APN 18 6937192 missense probably benign
IGL02478:Mkx APN 18 7002418 missense probably damaging 0.99
IGL02676:Mkx APN 18 7000640 missense probably benign 0.08
IGL02806:Mkx APN 18 6937025 missense probably damaging 1.00
R0766:Mkx UTSW 18 6937192 missense probably benign 0.05
R1312:Mkx UTSW 18 6937192 missense probably benign 0.05
R1496:Mkx UTSW 18 6992330 nonsense probably null
R2083:Mkx UTSW 18 6992855 missense probably damaging 0.99
R2196:Mkx UTSW 18 7000675 missense probably damaging 0.99
R3013:Mkx UTSW 18 6936929 missense probably damaging 0.99
R4544:Mkx UTSW 18 7000651 missense probably damaging 1.00
R4646:Mkx UTSW 18 6992040 missense probably benign 0.43
R4798:Mkx UTSW 18 7002432 missense probably benign
R4887:Mkx UTSW 18 6992904 missense probably damaging 1.00
R4945:Mkx UTSW 18 7000657 missense possibly damaging 0.76
R6129:Mkx UTSW 18 6992888 missense probably damaging 0.98
R6267:Mkx UTSW 18 7000591 critical splice donor site probably null
R6271:Mkx UTSW 18 6937059 splice site probably null
R6296:Mkx UTSW 18 7000591 critical splice donor site probably null
R6569:Mkx UTSW 18 6992820 nonsense probably null
R7165:Mkx UTSW 18 7002525 missense probably damaging 0.97
R7365:Mkx UTSW 18 7000747 missense possibly damaging 0.85
Z1088:Mkx UTSW 18 6936975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAGGCGGTAAATCCTGGCAGC -3'
(R):5'- TGGTCATTAGAACCACTACAGCCCC -3'

Sequencing Primer
(F):5'- GCGGACTCCTGATCTTGTTATAC -3'
(R):5'- GCAGCCATACCGAATTCTGG -3'
Posted On2014-01-29