Mutagenetix > Incidental Mutation

Incidental Mutation 'R1255:Sema6a'

151436

Institutional Source

Beutler Lab

Gene Symbol

Sema6a

Ensembl Gene

ENSMUSG00000019647

Gene Name

sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A

Synonyms

VIa, Semaq, Sema6A-1, sema, A730020P05Rik

MMRRC Submission

039322-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1255 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47378321-47504267 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47382366 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 701 (M701K)

Ref Sequence

ENSEMBL: ENSMUSP00000111109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000135790] [ENSMUST00000156422]

AlphaFold

O35464

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019791
AA Change: M727K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647
AA Change: M727K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	648	670	N/A	INTRINSIC
low complexity region	932	951	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076043
AA Change: M672K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647
AA Change: M672K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	593	615	N/A	INTRINSIC
low complexity region	877	896	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115449
AA Change: M701K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647
AA Change: M701K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	461	1.24e-168	SMART
PSI	488	543	9.57e-1	SMART
transmembrane domain	622	644	N/A	INTRINSIC
low complexity region	906	925	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123228

SMART Domains

Protein: ENSMUSP00000120249
Gene: ENSMUSG00000019647

Domain	Start	End	E-Value	Type
Blast:PSI	2	45	4e-26	BLAST
PDB:3OKY\|B	2	47	2e-26	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135790
AA Change: M744K

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647
AA Change: M744K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	949	968	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156422
AA Change: M727K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647
AA Change: M727K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	648	670	N/A	INTRINSIC
low complexity region	932	951	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 119,807,016 (GRCm39)	S21C	probably damaging	Het
Abcb10	C	T	8: 124,688,791 (GRCm39)	G495D	probably damaging	Het
Acsf3	T	C	8: 123,512,705 (GRCm39)		probably null	Het
Aff3	A	T	1: 38,243,965 (GRCm39)		probably null	Het
Antxr2	A	T	5: 98,123,231 (GRCm39)	I272N	probably benign	Het
Asphd2	A	C	5: 112,539,677 (GRCm39)	V52G	probably damaging	Het
Atxn3	T	A	12: 101,900,593 (GRCm39)	Q230L	probably damaging	Het
Bltp3b	T	C	10: 89,581,132 (GRCm39)	I9T	probably damaging	Het
Ccdc39	T	C	3: 33,880,629 (GRCm39)	K446R	probably damaging	Het
Ciz1	T	A	2: 32,255,888 (GRCm39)		probably null	Het
Dennd5b	A	T	6: 148,943,148 (GRCm39)	M576K	possibly damaging	Het
Ebf3	C	T	7: 136,826,941 (GRCm39)	V315I	probably benign	Het
Epha5	G	T	5: 84,298,254 (GRCm39)	A383E	probably damaging	Het
Epha5	C	T	5: 84,298,255 (GRCm39)	A383T	probably damaging	Het
Gimap1	T	A	6: 48,719,940 (GRCm39)	V184E	probably benign	Het
Gtf2f1	A	G	17: 57,317,982 (GRCm39)	V18A	probably damaging	Het
Kcnn3	A	T	3: 89,559,416 (GRCm39)	D562V	possibly damaging	Het
Kif20b	A	G	19: 34,927,506 (GRCm39)	T883A	probably benign	Het
Kmt2c	A	T	5: 25,556,151 (GRCm39)	L1198Q	probably damaging	Het
Nipal2	T	C	15: 34,584,828 (GRCm39)	I247V	probably benign	Het
Or5ak22	T	A	2: 85,230,647 (GRCm39)	I77F	probably damaging	Het
Rad51ap2	G	T	12: 11,508,095 (GRCm39)	K672N	possibly damaging	Het
Rbm28	C	T	6: 29,158,246 (GRCm39)	G155D	probably damaging	Het
Slc47a1	A	T	11: 61,260,974 (GRCm39)	L142Q	probably damaging	Het
Snx25	A	T	8: 46,569,275 (GRCm39)	N207K	probably benign	Het
Son	T	A	16: 91,461,583 (GRCm39)	V205E	probably damaging	Het
Spz1	C	A	13: 92,712,138 (GRCm39)	V113F	probably benign	Het
Tcn2	T	C	11: 3,872,120 (GRCm39)	T336A	probably benign	Het
Tln1	T	C	4: 43,538,044 (GRCm39)	D1852G	probably damaging	Het
Ugcg	C	T	4: 59,207,798 (GRCm39)	P46S	probably benign	Het
Zfp729a	T	C	13: 67,769,965 (GRCm39)	E88G	probably benign	Het

Other mutations in Sema6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Sema6a	APN	18	47,423,042 (GRCm39)	critical splice donor site	probably null
IGL01351:Sema6a	APN	18	47,414,369 (GRCm39)	missense	possibly damaging	0.84
IGL01594:Sema6a	APN	18	47,381,884 (GRCm39)	missense	probably damaging	1.00
IGL01953:Sema6a	APN	18	47,423,187 (GRCm39)	nonsense	probably null
IGL02077:Sema6a	APN	18	47,416,465 (GRCm39)	missense	possibly damaging	0.94
IGL02632:Sema6a	APN	18	47,423,222 (GRCm39)	missense	probably damaging	1.00
IGL02957:Sema6a	APN	18	47,382,291 (GRCm39)	missense	probably damaging	1.00
IGL03013:Sema6a	APN	18	47,381,461 (GRCm39)	missense	probably benign	0.01
IGL03279:Sema6a	APN	18	47,433,157 (GRCm39)	nonsense	probably null
saphire	UTSW	18	47,439,496 (GRCm39)	nonsense	probably null
IGL02988:Sema6a	UTSW	18	47,431,281 (GRCm39)	missense	probably damaging	1.00
R0114:Sema6a	UTSW	18	47,423,244 (GRCm39)	missense	probably damaging	1.00
R0311:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0312:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0347:Sema6a	UTSW	18	47,424,196 (GRCm39)	missense	probably damaging	1.00
R0350:Sema6a	UTSW	18	47,403,785 (GRCm39)	missense	probably benign
R0366:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0368:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0391:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0403:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0466:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0515:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0517:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0542:Sema6a	UTSW	18	47,381,643 (GRCm39)	missense	probably damaging	1.00
R0557:Sema6a	UTSW	18	47,382,567 (GRCm39)	missense	probably benign	0.01
R0569:Sema6a	UTSW	18	47,403,872 (GRCm39)	splice site	probably null
R0650:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0689:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0694:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0726:Sema6a	UTSW	18	47,425,048 (GRCm39)	missense	probably damaging	1.00
R0741:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0821:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0824:Sema6a	UTSW	18	47,423,112 (GRCm39)	splice site	probably null
R0924:Sema6a	UTSW	18	47,381,559 (GRCm39)	missense	probably damaging	1.00
R1108:Sema6a	UTSW	18	47,439,498 (GRCm39)	missense	probably benign	0.02
R1422:Sema6a	UTSW	18	47,439,498 (GRCm39)	missense	probably benign	0.02
R1531:Sema6a	UTSW	18	47,382,066 (GRCm39)	missense	probably damaging	1.00
R1707:Sema6a	UTSW	18	47,416,512 (GRCm39)	missense	probably benign	0.04
R1746:Sema6a	UTSW	18	47,439,416 (GRCm39)	splice site	probably benign
R1807:Sema6a	UTSW	18	47,409,491 (GRCm39)	missense	possibly damaging	0.85
R1974:Sema6a	UTSW	18	47,403,696 (GRCm39)	missense	probably benign	0.04
R1987:Sema6a	UTSW	18	47,433,209 (GRCm39)	missense	probably damaging	1.00
R2044:Sema6a	UTSW	18	47,439,496 (GRCm39)	nonsense	probably null
R3719:Sema6a	UTSW	18	47,382,144 (GRCm39)	missense	probably damaging	1.00
R4491:Sema6a	UTSW	18	47,439,524 (GRCm39)	utr 5 prime	probably benign
R4552:Sema6a	UTSW	18	47,424,990 (GRCm39)	missense	probably damaging	1.00
R4707:Sema6a	UTSW	18	47,381,779 (GRCm39)	missense	probably benign	0.43
R4710:Sema6a	UTSW	18	47,403,750 (GRCm39)	missense	probably benign	0.00
R4713:Sema6a	UTSW	18	47,382,363 (GRCm39)	missense	possibly damaging	0.79
R4963:Sema6a	UTSW	18	47,431,318 (GRCm39)	missense	possibly damaging	0.48
R5088:Sema6a	UTSW	18	47,382,196 (GRCm39)	missense	probably damaging	1.00
R5133:Sema6a	UTSW	18	47,433,195 (GRCm39)	missense	probably damaging	1.00
R5135:Sema6a	UTSW	18	47,424,239 (GRCm39)	missense	probably damaging	1.00
R5141:Sema6a	UTSW	18	47,381,455 (GRCm39)	missense	probably damaging	1.00
R5277:Sema6a	UTSW	18	47,409,611 (GRCm39)	intron	probably benign
R5551:Sema6a	UTSW	18	47,381,595 (GRCm39)	missense	possibly damaging	0.76
R5618:Sema6a	UTSW	18	47,415,015 (GRCm39)	missense	probably damaging	0.98
R5717:Sema6a	UTSW	18	47,382,330 (GRCm39)	missense	probably benign	0.01
R5729:Sema6a	UTSW	18	47,414,410 (GRCm39)	missense	probably damaging	1.00
R5779:Sema6a	UTSW	18	47,381,893 (GRCm39)	missense	probably damaging	1.00
R5917:Sema6a	UTSW	18	47,414,405 (GRCm39)	missense	probably benign	0.05
R6054:Sema6a	UTSW	18	47,416,470 (GRCm39)	missense	possibly damaging	0.94
R6142:Sema6a	UTSW	18	47,414,266 (GRCm39)	missense	probably benign	0.00
R6209:Sema6a	UTSW	18	47,431,369 (GRCm39)	splice site	probably null
R6307:Sema6a	UTSW	18	47,382,231 (GRCm39)	missense	probably damaging	1.00
R6734:Sema6a	UTSW	18	47,412,236 (GRCm39)	missense	probably benign	0.31
R7014:Sema6a	UTSW	18	47,431,284 (GRCm39)	missense	probably damaging	1.00
R7033:Sema6a	UTSW	18	47,381,637 (GRCm39)	missense	probably damaging	0.96
R7574:Sema6a	UTSW	18	47,424,231 (GRCm39)	missense	probably damaging	1.00
R8054:Sema6a	UTSW	18	47,424,972 (GRCm39)	missense	probably damaging	1.00
R8250:Sema6a	UTSW	18	47,423,182 (GRCm39)	missense	probably damaging	0.99
R8408:Sema6a	UTSW	18	47,381,958 (GRCm39)	missense	probably benign	0.34
R8411:Sema6a	UTSW	18	47,382,022 (GRCm39)	missense	probably benign	0.00
R8900:Sema6a	UTSW	18	47,424,182 (GRCm39)	missense	probably damaging	1.00
R9140:Sema6a	UTSW	18	47,415,009 (GRCm39)	missense	probably benign
R9158:Sema6a	UTSW	18	47,431,330 (GRCm39)	missense	probably damaging	0.98
R9488:Sema6a	UTSW	18	47,437,216 (GRCm39)	missense	probably damaging	1.00
R9565:Sema6a	UTSW	18	47,382,594 (GRCm39)	missense	probably null	1.00
R9652:Sema6a	UTSW	18	47,382,252 (GRCm39)	missense	probably damaging	1.00
R9732:Sema6a	UTSW	18	47,381,925 (GRCm39)	missense	probably damaging	0.96
X0065:Sema6a	UTSW	18	47,416,386 (GRCm39)	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TGGTCTTATACTCCAGGGTGGCAG -3'
(R):5'- TCTTCTCGGGCATCATCGTGTATTG -3'

Sequencing Primer
(F):5'- GGGCTGATCTACGTACTCG -3'
(R):5'- TGTGTGTGCGATCACCG -3'

Posted On

2014-01-29