Incidental Mutation 'R1256:Nif3l1'
ID151438
Institutional Source Beutler Lab
Gene Symbol Nif3l1
Ensembl Gene ENSMUSG00000026036
Gene NameNgg1 interacting factor 3-like 1 (S. pombe)
Synonyms
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58445151-58481816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58455649 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 259 (V259D)
Ref Sequence ENSEMBL: ENSMUSP00000109976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087521] [ENSMUST00000114337] [ENSMUST00000171597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087521
AA Change: V259D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084799
Gene: ENSMUSG00000026036
AA Change: V259D

DomainStartEndE-ValueType
Pfam:NIF3 31 363 1.9e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114337
AA Change: V259D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036
AA Change: V259D

DomainStartEndE-ValueType
Pfam:NIF3 31 324 4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140723
Predicted Effect possibly damaging
Transcript: ENSMUST00000171597
AA Change: V259D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127501
Gene: ENSMUSG00000026036
AA Change: V259D

DomainStartEndE-ValueType
Pfam:NIF3 31 363 2.5e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188295
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the NGG1-interacting factor 3-like superfamily of transcriptional regulators and is ubiquitously expressed throughout embryonic development. The encoded protein interacts with a component of the constitutive photomorphogenesis 9 signalosome, and functions as a transcriptional corepressor of genes involved in neuronal differentiation. This gene is highly conserved from bacteria to human. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Nif3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nif3l1 APN 1 58455686 missense possibly damaging 0.56
IGL01657:Nif3l1 APN 1 58455612 missense probably damaging 0.98
IGL02159:Nif3l1 APN 1 58447946 unclassified probably null
IGL02223:Nif3l1 APN 1 58448043 nonsense probably null
IGL02407:Nif3l1 APN 1 58457797 missense possibly damaging 0.87
IGL02435:Nif3l1 APN 1 58447861 missense possibly damaging 0.91
IGL02676:Nif3l1 APN 1 58455736 critical splice donor site probably null
IGL02721:Nif3l1 APN 1 58457849 missense probably damaging 1.00
R0472:Nif3l1 UTSW 1 58447828 missense probably damaging 1.00
R1036:Nif3l1 UTSW 1 58447873 missense probably damaging 1.00
R1439:Nif3l1 UTSW 1 58447943 missense probably damaging 1.00
R1483:Nif3l1 UTSW 1 58447726 missense probably benign 0.01
R2240:Nif3l1 UTSW 1 58452129 missense probably benign 0.35
R4379:Nif3l1 UTSW 1 58455579 intron probably benign
R4381:Nif3l1 UTSW 1 58455579 intron probably benign
R4552:Nif3l1 UTSW 1 58449324 unclassified probably benign
R6524:Nif3l1 UTSW 1 58457840 missense probably benign 0.01
R6567:Nif3l1 UTSW 1 58455630 missense probably benign 0.13
R6698:Nif3l1 UTSW 1 58450489 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCCCCTAATGTAGTGCCTACCTTGAT -3'
(R):5'- CCTGAGCTGCTAACAAGTTCTCTACC -3'

Sequencing Primer
(F):5'- GGCTTGCAATTGAAACTTTAGC -3'
(R):5'- caaacaaacaaacaaaaaaaaccaac -3'
Posted On2014-01-29