Incidental Mutation 'R1256:Capn10'
ID151439
Institutional Source Beutler Lab
Gene Symbol Capn10
Ensembl Gene ENSMUSG00000026270
Gene Namecalpain 10
SynonymsCapn8
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92934376-92947941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92946946 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 633 (T633M)
Ref Sequence ENSEMBL: ENSMUSP00000027488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027488] [ENSMUST00000152983] [ENSMUST00000185421]
Predicted Effect probably damaging
Transcript: ENSMUST00000027488
AA Change: T633M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027488
Gene: ENSMUSG00000026270
AA Change: T633M

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.05e-60 SMART
calpain_III 507 645 1.3e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136598
Predicted Effect probably benign
Transcript: ENSMUST00000152983
SMART Domains Protein: ENSMUSP00000122158
Gene: ENSMUSG00000026270

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.71e-60 SMART
low complexity region 490 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153828
Predicted Effect probably benign
Transcript: ENSMUST00000185421
Predicted Effect probably benign
Transcript: ENSMUST00000187342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191563
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to ryanodine- and palmitate-induced pancreatic apoptosis. Mice homozygous for a different knock-out allele exhibit increased adiposity, body and organ weights, and leptin serum levels on background containing LG/J. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Capn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Capn10 APN 1 92942559 missense probably benign 0.00
IGL01071:Capn10 APN 1 92945075 missense probably damaging 1.00
IGL01682:Capn10 APN 1 92940384 missense probably benign 0.16
IGL01771:Capn10 APN 1 92940365 missense probably damaging 1.00
IGL02952:Capn10 APN 1 92945174 missense probably damaging 0.97
IGL03177:Capn10 APN 1 92934982 missense probably benign 0.02
IGL03224:Capn10 APN 1 92939324 missense probably damaging 1.00
P4717OSA:Capn10 UTSW 1 92939394 missense probably damaging 1.00
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1653:Capn10 UTSW 1 92946898 missense probably damaging 1.00
R1737:Capn10 UTSW 1 92934955 missense probably benign 0.10
R2127:Capn10 UTSW 1 92938034 nonsense probably null
R2433:Capn10 UTSW 1 92942525 missense probably benign 0.22
R2484:Capn10 UTSW 1 92944843 missense probably damaging 0.97
R4004:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4005:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4560:Capn10 UTSW 1 92939362 missense probably damaging 1.00
R4684:Capn10 UTSW 1 92943781 missense probably damaging 1.00
R4766:Capn10 UTSW 1 92943419 missense probably damaging 0.98
R4996:Capn10 UTSW 1 92945136 missense probably damaging 1.00
R5665:Capn10 UTSW 1 92937931 splice site probably null
R5733:Capn10 UTSW 1 92943913 missense probably benign 0.03
R5937:Capn10 UTSW 1 92939383 missense probably damaging 1.00
R6985:Capn10 UTSW 1 92943424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAGTGAGAGCAAACCATGCC -3'
(R):5'- AGACCAGCAGGGAGTCTCAAAGTC -3'

Sequencing Primer
(F):5'- AATTGCACTGTTGCCCAGG -3'
(R):5'- AAGCACAAGGCTCATAGGGA -3'
Posted On2014-01-29