Incidental Mutation 'R1256:Magi3'
ID151444
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms4732496O19Rik, 6530407C02Rik
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R1256 (G1)
Quality Score118
Status Not validated
Chromosome3
Chromosomal Location104013259-104220374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104027810 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 936 (V936I)
Ref Sequence ENSEMBL: ENSMUSP00000113713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303] [ENSMUST00000145727]
Predicted Effect probably benign
Transcript: ENSMUST00000064371
AA Change: V936I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: V936I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121198
AA Change: V936I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: V936I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122303
AA Change: V936I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: V936I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145727
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 intron probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACACCTCTCACATACTCTGGGCT -3'
(R):5'- AGGCAGCAGCAAGCATCTATCTG -3'

Sequencing Primer
(F):5'- agcccaaactaaagcccac -3'
(R):5'- AAAACTTGGGGTTCTTGCCAC -3'
Posted On2014-01-29