Incidental Mutation 'R1256:Tstd3'
ID151445
Institutional Source Beutler Lab
Gene Symbol Tstd3
Ensembl Gene ENSMUSG00000028251
Gene Namethiosulfate sulfurtransferase (rhodanese)-like domain containing 3
Synonyms
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location21757382-21767212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21759627 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 79 (I79M)
Ref Sequence ENSEMBL: ENSMUSP00000029915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029915] [ENSMUST00000120679]
Predicted Effect probably damaging
Transcript: ENSMUST00000029915
AA Change: I79M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029915
Gene: ENSMUSG00000028251
AA Change: I79M

DomainStartEndE-ValueType
RHOD 42 151 1.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120679
SMART Domains Protein: ENSMUSP00000113682
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Tstd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02108:Tstd3 APN 4 21759366 intron probably benign
R1699:Tstd3 UTSW 4 21759400 missense probably benign 0.01
R1771:Tstd3 UTSW 4 21759475 missense probably damaging 1.00
R1776:Tstd3 UTSW 4 21759475 missense probably damaging 1.00
R2847:Tstd3 UTSW 4 21759375 missense possibly damaging 0.90
R5047:Tstd3 UTSW 4 21759621 critical splice donor site probably null
R5838:Tstd3 UTSW 4 21759622 critical splice donor site probably null
R6960:Tstd3 UTSW 4 21767118 start codon destroyed probably null 0.01
X0058:Tstd3 UTSW 4 21759779 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACACACCTGTTAAAGCCCAGTG -3'
(R):5'- AGTCAATATGGAGATGCAGCCAAGC -3'

Sequencing Primer
(F):5'- TGATATTGCTGTGTCCATAGCC -3'
(R):5'- GATGCAGCCAAGCATTTTGTTC -3'
Posted On2014-01-29