Incidental Mutation 'R1256:Pepd'
ID151451
Institutional Source Beutler Lab
Gene Symbol Pepd
Ensembl Gene ENSMUSG00000063931
Gene Namepeptidase D
SynonymsPep4, Pep-4, dal, peptidase D
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location34912379-35044708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34921492 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 61 (T61P)
Ref Sequence ENSEMBL: ENSMUSP00000075683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075068
AA Change: T61P

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931
AA Change: T61P

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants are smaller than normal siblings and, except on the flanks, an agouti coat appears nonagouti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Pepd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pepd APN 7 34924440 missense probably benign
IGL02102:Pepd APN 7 34945603 missense probably damaging 1.00
R1690:Pepd UTSW 7 35031357 missense probably damaging 1.00
R1734:Pepd UTSW 7 35031426 missense probably benign 0.07
R1911:Pepd UTSW 7 34934749 splice site probably benign
R1918:Pepd UTSW 7 34971676 missense probably benign 0.00
R2144:Pepd UTSW 7 34921418 missense probably benign 0.09
R4814:Pepd UTSW 7 34945597 missense probably damaging 0.96
R4924:Pepd UTSW 7 35020984 missense probably benign 0.24
R5490:Pepd UTSW 7 34942690 splice site probably null
R5669:Pepd UTSW 7 35040674 missense probably benign 0.38
R6240:Pepd UTSW 7 35021751 missense probably benign 0.00
R6300:Pepd UTSW 7 34969543 missense probably damaging 1.00
R6479:Pepd UTSW 7 35040722 missense probably benign 0.00
R6995:Pepd UTSW 7 35021719 missense probably damaging 1.00
X0021:Pepd UTSW 7 34954563 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTAGCACAAGTTGCCCAGAGTCC -3'
(R):5'- TAAACTGTAGCCAGTGGCCCAGAC -3'

Sequencing Primer
(F):5'- GGCACAGACCCCAGGTAATG -3'
(R):5'- ATCTCTGCCCAACAGGTGAG -3'
Posted On2014-01-29