Incidental Mutation 'R1256:Cln3'
ID151454
Institutional Source Beutler Lab
Gene Symbol Cln3
Ensembl Gene ENSMUSG00000030720
Gene Nameceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)
Synonymsbattenin
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126571207-126585817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126583036 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 4 (S4P)
Ref Sequence ENSEMBL: ENSMUSP00000138688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032962] [ENSMUST00000039522] [ENSMUST00000084589] [ENSMUST00000098036] [ENSMUST00000116269] [ENSMUST00000125508] [ENSMUST00000128970] [ENSMUST00000131860] [ENSMUST00000137646] [ENSMUST00000138558] [ENSMUST00000144173] [ENSMUST00000147086] [ENSMUST00000150311] [ENSMUST00000150587] [ENSMUST00000150917]
Predicted Effect probably benign
Transcript: ENSMUST00000032962
AA Change: S4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032962
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039522
SMART Domains Protein: ENSMUSP00000042028
Gene: ENSMUSG00000042759

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 171 181 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
low complexity region 588 608 N/A INTRINSIC
low complexity region 837 862 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084589
AA Change: S4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098036
AA Change: S4P

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095644
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 37 414 4.3e-191 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116269
AA Change: S4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111973
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 39 437 1.6e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125508
AA Change: S4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117561
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 37 76 1.2e-17 PFAM
Pfam:CLN3 73 151 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128225
Predicted Effect probably benign
Transcript: ENSMUST00000128970
AA Change: S4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114901
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 37 196 1.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134498
Predicted Effect probably benign
Transcript: ENSMUST00000137646
Predicted Effect probably benign
Transcript: ENSMUST00000138558
Predicted Effect probably benign
Transcript: ENSMUST00000144173
Predicted Effect possibly damaging
Transcript: ENSMUST00000147086
AA Change: S4P

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000150311
AA Change: S4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116160
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 37 69 1.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150587
AA Change: S4P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118054
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 37 70 4.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150917
AA Change: S4P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138688
Gene: ENSMUSG00000030720
AA Change: S4P

DomainStartEndE-ValueType
Pfam:CLN3 37 77 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184825
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein called battenin that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis genes, cause a number of neurodegenerative diseases collectively known as neuronal ceroid lipofuscinoses, the most common of which is juvenile neuronal ceroid-lipofuscinosis (Batten disease). Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Nullizygous mutations can result in neuronal ceroid lipofuscinosis, degeneration of the retina, cerebral cortex and cerebellum, hypertrophy of hippocampal interneuron populations, gliosis, neurological deficits, and premature death. Homozygotes for a null allele show impaired water and K+ balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Cln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Cln3 APN 7 126575254 missense probably damaging 1.00
IGL01603:Cln3 APN 7 126575354 missense probably benign 0.30
IGL02216:Cln3 APN 7 126575342 critical splice donor site probably null
IGL02440:Cln3 APN 7 126582782 missense probably benign 0.01
IGL03118:Cln3 APN 7 126575397 missense probably null 0.00
R0326:Cln3 UTSW 7 126583045 start codon destroyed probably damaging 0.96
R0610:Cln3 UTSW 7 126580189 missense probably damaging 1.00
R2136:Cln3 UTSW 7 126582799 missense probably benign 0.00
R2202:Cln3 UTSW 7 126579218 missense probably benign 0.11
R3977:Cln3 UTSW 7 126580136 splice site probably benign
R4563:Cln3 UTSW 7 126572558 missense probably damaging 0.98
R4690:Cln3 UTSW 7 126575393 missense possibly damaging 0.61
R4936:Cln3 UTSW 7 126575221 missense probably damaging 1.00
R5668:Cln3 UTSW 7 126572386 missense probably benign 0.01
R5726:Cln3 UTSW 7 126575501 missense probably null 0.00
R6385:Cln3 UTSW 7 126575035 missense probably null 1.00
R6591:Cln3 UTSW 7 126579434 missense possibly damaging 0.82
R6691:Cln3 UTSW 7 126579434 missense possibly damaging 0.82
R6891:Cln3 UTSW 7 126582803 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCATTCTTCCAAAGGACACTCCGAC -3'
(R):5'- GTGTATAGCAGACAGCGGAACCTG -3'

Sequencing Primer
(F):5'- TCCGACTATCCAACCGAGGG -3'
(R):5'- AGCGGAACCTGGGACTG -3'
Posted On2014-01-29