Incidental Mutation 'R1256:Abcb10'
ID151458
Institutional Source Beutler Lab
Gene Symbol Abcb10
Ensembl Gene ENSMUSG00000031974
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 10
SynonymsABC-me
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123952459-123983122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123962052 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 495 (G495D)
Ref Sequence ENSEMBL: ENSMUSP00000075011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075578] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000075578
AA Change: G495D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075011
Gene: ENSMUSG00000031974
AA Change: G495D

DomainStartEndE-ValueType
Pfam:ABC_membrane 136 407 1.7e-60 PFAM
AAA 484 675 1.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212356
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ATP-binding cassette superfamily of transporters. ATP-binding cassette proteins transport various molecules across extra- and intra-cellular membranes. The encoded protein is localized to the mitochondrial inner membrane where it interacts with and stabilizes mitoferrin-1, and is important for heme biosynthesis. Additional evidence suggests the encoded protein is involved in oxidative stress protection and erythropoisesis. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased response to ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Abcb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Abcb10 APN 8 123954427 missense probably benign 0.00
IGL02279:Abcb10 APN 8 123954361 missense probably benign 0.17
IGL02302:Abcb10 APN 8 123958672 missense possibly damaging 0.89
IGL02342:Abcb10 APN 8 123962034 missense probably damaging 1.00
IGL03062:Abcb10 APN 8 123954315 missense possibly damaging 0.49
IGL03409:Abcb10 APN 8 123965023 missense possibly damaging 0.63
R0320:Abcb10 UTSW 8 123963007 missense probably benign 0.00
R0436:Abcb10 UTSW 8 123971001 missense probably benign 0.01
R1074:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1224:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1225:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1226:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1251:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1252:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1254:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1255:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1355:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1370:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1424:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1499:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1769:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R2096:Abcb10 UTSW 8 123982456 missense probably benign 0.01
R2125:Abcb10 UTSW 8 123965092 missense probably benign 0.29
R2274:Abcb10 UTSW 8 123982752 missense probably benign 0.23
R4801:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4802:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4850:Abcb10 UTSW 8 123982690 missense probably benign 0.01
R5320:Abcb10 UTSW 8 123971024 missense probably benign 0.11
R5947:Abcb10 UTSW 8 123967998 splice site probably null
R6006:Abcb10 UTSW 8 123968065 missense probably benign 0.00
R6328:Abcb10 UTSW 8 123962017 missense probably damaging 1.00
V7581:Abcb10 UTSW 8 123969761 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCACATGTCAGCAGAGTTCCAG -3'
(R):5'- ACTTCAGTCAGGCAAGGGAGACAC -3'

Sequencing Primer
(F):5'- CTGACCCATTTCCAAGGGTAG -3'
(R):5'- GGCATTCTGCCCTGAGC -3'
Posted On2014-01-29