Incidental Mutation 'R1256:Kdelc2'
ID151460
Institutional Source Beutler Lab
Gene Symbol Kdelc2
Ensembl Gene ENSMUSG00000034487
Gene NameKDEL (Lys-Asp-Glu-Leu) containing 2
Synonyms
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53384025-53401867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53388462 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 90 (R90S)
Ref Sequence ENSEMBL: ENSMUSP00000039313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037853] [ENSMUST00000214164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037853
AA Change: R90S

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039313
Gene: ENSMUSG00000034487
AA Change: R90S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG_FLMN 23 132 2.17e-2 SMART
Blast:CAP10 135 224 5e-48 BLAST
CAP10 226 471 7.45e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214164
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Kdelc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdelc2 APN 9 53398028 intron probably benign
IGL00334:Kdelc2 APN 9 53398030 intron probably benign
IGL01061:Kdelc2 APN 9 53388587 unclassified probably benign
IGL01114:Kdelc2 APN 9 53388579 critical splice donor site probably null
IGL02227:Kdelc2 APN 9 53388479 missense probably damaging 0.97
IGL02646:Kdelc2 APN 9 53384251 missense probably benign 0.06
IGL02795:Kdelc2 APN 9 53392105 missense probably damaging 1.00
IGL03029:Kdelc2 APN 9 53384288 critical splice donor site probably null
R0830:Kdelc2 UTSW 9 53390711 missense probably damaging 1.00
R1806:Kdelc2 UTSW 9 53395850 missense probably damaging 1.00
R5995:Kdelc2 UTSW 9 53395895 missense probably damaging 0.98
R6170:Kdelc2 UTSW 9 53399742 missense possibly damaging 0.91
R6348:Kdelc2 UTSW 9 53390440 missense probably damaging 0.97
R6833:Kdelc2 UTSW 9 53392008 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AAGGATGGACCACACATAGTTGCTG -3'
(R):5'- AGCCCTTCTGAAAAGCAAGTATCCC -3'

Sequencing Primer
(F):5'- TCTTCCAGGCTGAAATGAGC -3'
(R):5'- CACTGCCATGAAGGATCTCT -3'
Posted On2014-01-29