Incidental Mutation 'R1256:Mcu'
ID151462
Institutional Source Beutler Lab
Gene Symbol Mcu
Ensembl Gene ENSMUSG00000009647
Gene Namemitochondrial calcium uniporter
Synonyms2010012O16Rik, Ccdc109a, D130073L02Rik
MMRRC Submission 039323-MU
Accession Numbers

Genbank: NM_001033259; MGI: 3026965

Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location59446984-59616692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59454968 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 279 (A279E)
Ref Sequence ENSEMBL: ENSMUSP00000020312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009791] [ENSMUST00000020312]
Predicted Effect probably damaging
Transcript: ENSMUST00000009791
AA Change: A130E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009791
Gene: ENSMUSG00000009647
AA Change: A130E

DomainStartEndE-ValueType
Pfam:DUF607 1 171 3.7e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000020312
AA Change: A279E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020312
Gene: ENSMUSG00000009647
AA Change: A279E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
Pfam:MCU 114 319 3.5e-78 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium transporter that localizes to the mitochondrial inner membrane. The encoded protein interacts with mitochondrial calcium uptake 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired calcium-induced permeability transition pore opening, decreased body size and weight, decreased exercise endurance and decreased grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Mcu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:Mcu APN 10 59467644 missense probably damaging 1.00
IGL03074:Mcu APN 10 59467758 missense probably damaging 0.99
R0201:Mcu UTSW 10 59456677 missense probably damaging 1.00
R0445:Mcu UTSW 10 59456645 splice site probably benign
R1497:Mcu UTSW 10 59448848 missense probably damaging 1.00
R2322:Mcu UTSW 10 59454944 critical splice donor site probably null
R2404:Mcu UTSW 10 59467704 missense probably damaging 1.00
R4517:Mcu UTSW 10 59467634 missense probably damaging 1.00
R4666:Mcu UTSW 10 59456699 missense probably damaging 1.00
R4821:Mcu UTSW 10 59467689 missense probably damaging 0.99
R5940:Mcu UTSW 10 59456732 missense possibly damaging 0.94
R6949:Mcu UTSW 10 59456744 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGAAGCAACTCTGCACATGCAC -3'
(R):5'- TCTGCCGCTGTTATTTAGGAAACCG -3'

Sequencing Primer
(F):5'- TGCACATGCACCCTAGTG -3'
(R):5'- CTAAAAGCCTGTGACTGATGTTGTC -3'
Posted On2014-01-29