Incidental Mutation 'R1256:Ralgapa1'
ID151466
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55762661 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 443 (E443G)
Ref Sequence ENSEMBL: ENSMUSP00000151857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085385
AA Change: E443G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: E443G

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110687
AA Change: E443G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: E443G

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219432
AA Change: E443G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219542
Predicted Effect possibly damaging
Transcript: ENSMUST00000220367
AA Change: E443G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000226244
AA Change: E443G

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 intron probably null
R2203:Ralgapa1 UTSW 12 55612800 intron probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6593:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGGTGAGAAAAGGTTACGATGCCC -3'
(R):5'- AAACAAATCTCTGCTCCTCCTTCTTCAG -3'

Sequencing Primer
(F):5'- aaaataaaaATGTGACATCACAGAGC -3'
(R):5'- CCAATTTGTGAAGCAGCAGCTAT -3'
Posted On2014-01-29