Incidental Mutation 'R1256:Vsx2'
ID151467
Institutional Source Beutler Lab
Gene Symbol Vsx2
Ensembl Gene ENSMUSG00000021239
Gene Namevisual system homeobox 2
SynonymsHox10, Chx10, Hox-10
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.750) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84569762-84595457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84576311 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 163 (L163Q)
Ref Sequence ENSEMBL: ENSMUSP00000131009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021665] [ENSMUST00000169934]
Predicted Effect probably damaging
Transcript: ENSMUST00000021665
AA Change: L163Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021665
Gene: ENSMUSG00000021239
AA Change: L163Q

DomainStartEndE-ValueType
low complexity region 77 86 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
HOX 148 210 4e-26 SMART
low complexity region 284 295 N/A INTRINSIC
Pfam:OAR 299 319 4.3e-10 PFAM
low complexity region 334 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169934
AA Change: L163Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131009
Gene: ENSMUSG00000021239
AA Change: L163Q

DomainStartEndE-ValueType
low complexity region 77 86 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
HOX 148 210 4e-26 SMART
low complexity region 303 314 N/A INTRINSIC
Pfam:OAR 319 337 6.6e-10 PFAM
low complexity region 353 369 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Vsx (visual system homeobox) family which belongs to the larger PRD homeobox class. The encoded protein is required for eye organogenesis and controls retinal development. Disruption of this gene is associated with ocular retardation J (orJ), a mouse disease which causes microphthalmia, retinal degeneration and optic nerve aplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microphthalmia, lack of retinal intercellular channels, and agenesis of the optic nerve. Homozygotes for one mutant allele also have a germ cell maturation defect with sterility in both sexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Other mutations in Vsx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:Vsx2 APN 12 84570300 missense probably benign 0.09
R0005:Vsx2 UTSW 12 84570241 missense possibly damaging 0.78
R0413:Vsx2 UTSW 12 84570003 missense probably benign 0.00
R3438:Vsx2 UTSW 12 84570211 missense probably damaging 0.98
R5199:Vsx2 UTSW 12 84593210 missense probably benign 0.31
R6481:Vsx2 UTSW 12 84593104 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTCCCACCAGAGTGCTTCCAG -3'
(R):5'- AGCAGGACTTATCCGCCTAGCTTC -3'

Sequencing Primer
(F):5'- gagagagagagagagagagagag -3'
(R):5'- tgtttgtttgtttgtttgtttgtttg -3'
Posted On2014-01-29