Incidental Mutation 'R1256:Dscr3'
ID151472
Institutional Source Beutler Lab
Gene Symbol Dscr3
Ensembl Gene ENSMUSG00000022898
Gene NameDSCR3 arrestin fold containing
SynonymsDcra
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location94497783-94526830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94512366 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 22 (L22P)
Ref Sequence ENSEMBL: ENSMUSP00000156097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023615] [ENSMUST00000125229]
Predicted Effect probably damaging
Transcript: ENSMUST00000023615
AA Change: L22P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023615
Gene: ENSMUSG00000022898
AA Change: L22P

DomainStartEndE-ValueType
Pfam:Vps26 3 283 2.5e-79 PFAM
Pfam:Arrestin_N 5 144 9.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125229
AA Change: L22P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210205
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The region of chromosome 21 between genes CBR and ERG (CBR-ERG region), which spans 2.5 Mb on 21q22.2, has been defined by analysis of patients with partial trisomy 21. It contributes significantly to the pathogenesis of many characteristics of Down syndrome, including morphological features, hypotonia, and mental retardation. The DSCR3 (Down syndrome critical region gene 3) gene is found in this region and is predictated to contain eight exons. DSCR3 is expressed in most tissues examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Dscr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02197:Dscr3 APN 16 94501690 splice site probably benign
R0644:Dscr3 UTSW 16 94502195 missense probably damaging 1.00
R1973:Dscr3 UTSW 16 94501546 missense probably damaging 0.99
R2286:Dscr3 UTSW 16 94512253 missense possibly damaging 0.69
R3854:Dscr3 UTSW 16 94510806 missense probably benign 0.01
R3855:Dscr3 UTSW 16 94510806 missense probably benign 0.01
R5067:Dscr3 UTSW 16 94526404 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTCGGATGACTCAAGTCAACAC -3'
(R):5'- TGATACATCACTGTTGTTGGGCAGG -3'

Sequencing Primer
(F):5'- GGATGACTCAAGTCAACACAAGTTTC -3'
(R):5'- ACTGTTGTTGGGCAGGGTTAG -3'
Posted On2014-01-29