Incidental Mutation 'R1256:Msln'
ID151473
Institutional Source Beutler Lab
Gene Symbol Msln
Ensembl Gene ENSMUSG00000063011
Gene Namemesothelin
SynonymsMPF, megakaryocyte potentiating factor
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25748614-25754327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25754183 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 13 (C13R)
Ref Sequence ENSEMBL: ENSMUSP00000075279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075884]
Predicted Effect probably damaging
Transcript: ENSMUST00000075884
AA Change: C13R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011
AA Change: C13R

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to generate two protein products, megakaryocyte potentiating factor and mesothelin. Megakaryocyte potentiating factor functions as a cytokine that can stimulate colony formation of bone marrow megakaryocytes. Mesothelin is a glycosylphosphatidylinositol-anchored cell-surface protein that may function as a cell adhesion protein. This protein is overexpressed in epithelial mesotheliomas, ovarian cancers and in specific squamous cell carcinomas. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this allele display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Msln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Msln APN 17 25750030 critical splice donor site probably null
IGL02986:Msln APN 17 25752933 splice site probably benign
R0349:Msln UTSW 17 25750276 missense possibly damaging 0.69
R0562:Msln UTSW 17 25753006 missense probably benign 0.16
R0845:Msln UTSW 17 25750796 missense probably damaging 1.00
R1305:Msln UTSW 17 25753027 missense probably benign 0.00
R1651:Msln UTSW 17 25753408 missense probably benign 0.00
R1930:Msln UTSW 17 25751922 missense probably damaging 0.99
R1996:Msln UTSW 17 25754219 start codon destroyed possibly damaging 0.94
R4532:Msln UTSW 17 25750724 missense probably damaging 0.98
R5004:Msln UTSW 17 25754219 start codon destroyed possibly damaging 0.94
R5157:Msln UTSW 17 25752983 missense probably benign 0.01
R5159:Msln UTSW 17 25751589 missense probably benign 0.01
R5510:Msln UTSW 17 25749873 missense probably benign 0.15
R6385:Msln UTSW 17 25751141 missense probably benign 0.19
R6650:Msln UTSW 17 25750170 missense probably benign 0.00
R6682:Msln UTSW 17 25753019 missense probably damaging 0.99
R7091:Msln UTSW 17 25750080 missense not run
X0002:Msln UTSW 17 25752310 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGGAACGCAGGTCACCTAGCAATG -3'
(R):5'- TGGTACAAACGGCGAACCCGTAAC -3'

Sequencing Primer
(F):5'- CCTAGCAATGACCCAAGGAG -3'
(R):5'- TGGAGAGTCTGCCTAGTAGACAC -3'
Posted On2014-01-29