Incidental Mutation 'R1256:Txnl4a'
ID151477
Institutional Source Beutler Lab
Gene Symbol Txnl4a
Ensembl Gene ENSMUSG00000057130
Gene Namethioredoxin-like 4A
SynonymsTxnl4, U5-15kDa, ENSMUSG00000057130, D18Wsu98e
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80206795-80223533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80207272 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 28 (I28V)
Ref Sequence ENSEMBL: ENSMUSP00000025464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025463] [ENSMUST00000025464] [ENSMUST00000125127] [ENSMUST00000127234] [ENSMUST00000145963]
Predicted Effect probably benign
Transcript: ENSMUST00000025463
SMART Domains Protein: ENSMUSP00000025463
Gene: ENSMUSG00000024571

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 32 125 7.1e-8 PFAM
Pfam:Acetyltransf_7 40 130 2e-9 PFAM
Pfam:Acetyltransf_1 46 129 6.1e-18 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025464
AA Change: I28V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025464
Gene: ENSMUSG00000057130
AA Change: I28V

DomainStartEndE-ValueType
Pfam:DIM1 4 93 4.1e-49 PFAM
Pfam:Thioredoxin 8 91 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125127
SMART Domains Protein: ENSMUSP00000123193
Gene: ENSMUSG00000024571

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 40 129 2.3e-9 PFAM
Pfam:Acetyltransf_1 46 129 1e-17 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126360
Predicted Effect probably benign
Transcript: ENSMUST00000127234
SMART Domains Protein: ENSMUSP00000121883
Gene: ENSMUSG00000024571

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 32 125 7.1e-8 PFAM
Pfam:Acetyltransf_7 40 130 2e-9 PFAM
Pfam:Acetyltransf_1 46 129 6.1e-18 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145116
Predicted Effect probably benign
Transcript: ENSMUST00000145963
AA Change: I28V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115320
Gene: ENSMUSG00000057130
AA Change: I28V

DomainStartEndE-ValueType
Pfam:DIM1 4 136 3.4e-73 PFAM
Pfam:Thioredoxin 8 109 3.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156400
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein interactions have been observed with the polyglutamine tract-binding protein 1 (PQBP1). Mutations in both the coding region and promoter region of this gene have been associated with Burn-McKeown syndrome, which is a rare disorder characterized by craniofacial dysmorphisms, cardiac defects, hearing loss, and bilateral choanal atresia. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Txnl4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Txnl4a APN 18 80218741 missense probably benign 0.02
IGL02349:Txnl4a APN 18 80218729 missense probably damaging 1.00
R1263:Txnl4a UTSW 18 80207321 missense probably benign 0.02
R1381:Txnl4a UTSW 18 80207264 missense probably benign 0.01
R4165:Txnl4a UTSW 18 80222256 missense probably benign 0.28
R4166:Txnl4a UTSW 18 80222256 missense probably benign 0.28
R4836:Txnl4a UTSW 18 80222253 missense probably damaging 1.00
R4903:Txnl4a UTSW 18 80207278 missense probably damaging 0.98
R6026:Txnl4a UTSW 18 80207267 missense probably damaging 0.98
R6275:Txnl4a UTSW 18 80218765 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCTCACACGAGGTTAGAGGTCGTC -3'
(R):5'- CTGCATGGAACACAGGACTCGG -3'

Sequencing Primer
(F):5'- AGCCGAGGCCCTGTATG -3'
(R):5'- GGCTTGAAATCTGGCGTCC -3'
Posted On2014-01-29