Incidental Mutation 'R1257:1700024P04Rik'
List |< first << previous [record 4 of 1308] next >> last >|
ID151506
Institutional Source Beutler Lab
Gene Symbol 1700024P04Rik
Ensembl Gene ENSMUSG00000045022
Gene NameRIKEN cDNA 1700024P04 gene
SynonymsH2BL1
MMRRC Submission 039324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R1257 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location98984085-98984565 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 98984515 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000053046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054425]
Predicted Effect probably null
Transcript: ENSMUST00000054425
AA Change: M1K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053046
Gene: ENSMUSG00000045022
AA Change: M1K

DomainStartEndE-ValueType
H2B 21 122 1.43e-22 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl A T 2: 128,044,366 T174S probably benign Het
Ank3 C T 10: 69,874,835 R408* probably null Het
Ceacam15 A G 7: 16,672,024 S201P possibly damaging Het
Ceacam20 A G 7: 19,974,192 I241V probably benign Het
Cfap46 A T 7: 139,654,629 L237* probably null Het
Col4a3 T A 1: 82,716,365 C133S probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Dnhd1 T A 7: 105,694,153 V1568D probably damaging Het
Fam208b T C 13: 3,575,049 T1634A probably benign Het
Gli3 C T 13: 15,725,996 Q1323* probably null Het
Gm884 A G 11: 103,534,641 V1462A unknown Het
Grhpr A G 4: 44,989,045 N287S probably damaging Het
Hectd4 G A 5: 121,318,624 W684* probably null Het
Kifc3 A G 8: 95,105,772 V474A probably damaging Het
Mdn1 A T 4: 32,667,089 probably null Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Nid1 T C 13: 13,483,790 Y707H probably benign Het
Nol4 A T 18: 22,770,681 N339K probably damaging Het
Olfr799 A T 10: 129,647,544 K139* probably null Het
Rbm34 C T 8: 126,970,893 G23S possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Snap25 A T 2: 136,758,348 E37V probably damaging Het
Taf1a A G 1: 183,397,837 T118A possibly damaging Het
Thrb T A 14: 18,008,642 I122K probably damaging Het
Xkr4 T G 1: 3,216,813 I385L probably benign Het
Zeb1 G T 18: 5,772,699 R996L possibly damaging Het
Other mutations in 1700024P04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:1700024P04Rik APN 13 98984142 utr 3 prime probably benign
IGL02148:1700024P04Rik APN 13 98984183 missense probably damaging 1.00
IGL02164:1700024P04Rik APN 13 98984207 missense probably damaging 0.97
R0727:1700024P04Rik UTSW 13 98984227 missense probably benign 0.38
R5340:1700024P04Rik UTSW 13 98984443 missense possibly damaging 0.95
R6298:1700024P04Rik UTSW 13 98984466 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTCGGCAACAGCAGATGCAC -3'
(R):5'- GAGCCACTTTCTCCTCAGCAACAG -3'

Sequencing Primer
(F):5'- GCGCTTTCTGAGGAACATC -3'
(R):5'- TCCTCAGCAACAGGTCGG -3'
Posted On2014-01-29