Incidental Mutation 'R1257:Zeb1'
ID151509
Institutional Source Beutler Lab
Gene Symbol Zeb1
Ensembl Gene ENSMUSG00000024238
Gene Namezinc finger E-box binding homeobox 1
Synonyms3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1
MMRRC Submission 039324-MU
Accession Numbers

Genbank: NM_011546; MGI: 1344313

Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R1257 (G1)
Quality Score207
Status Not validated
Chromosome18
Chromosomal Location5591860-5775467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5772699 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 996 (R996L)
Ref Sequence ENSEMBL: ENSMUSP00000025081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025081
AA Change: R996L

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: R996L

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 150 173 3.16e-3 SMART
ZnF_C2H2 180 202 3.21e-4 SMART
ZnF_C2H2 220 242 4.87e-4 SMART
ZnF_C2H2 248 268 1.86e1 SMART
low complexity region 288 304 N/A INTRINSIC
low complexity region 532 555 N/A INTRINSIC
HOX 559 621 7.53e-3 SMART
low complexity region 730 742 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
ZnF_C2H2 882 904 1.18e-2 SMART
ZnF_C2H2 910 932 4.4e-2 SMART
ZnF_C2H2 938 959 1.89e-1 SMART
coiled coil region 1006 1077 N/A INTRINSIC
low complexity region 1096 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162892
SMART Domains Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 94 117 1.3e-5 SMART
ZnF_C2H2 124 146 1.3e-6 SMART
ZnF_C2H2 164 186 2e-6 SMART
ZnF_C2H2 192 212 7.8e-2 SMART
low complexity region 232 248 N/A INTRINSIC
low complexity region 476 499 N/A INTRINSIC
HOX 503 565 3.9e-5 SMART
low complexity region 674 686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177030
SMART Domains Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 22 44 4.87e-4 SMART
low complexity region 277 300 N/A INTRINSIC
HOX 304 366 7.53e-3 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
ZnF_C2H2 627 649 1.18e-2 SMART
ZnF_C2H2 655 677 4.4e-2 SMART
ZnF_C2H2 683 704 1.89e-1 SMART
low complexity region 758 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A T 13: 98,984,515 M1K probably null Het
Acoxl A T 2: 128,044,366 T174S probably benign Het
Ank3 C T 10: 69,874,835 R408* probably null Het
Ceacam15 A G 7: 16,672,024 S201P possibly damaging Het
Ceacam20 A G 7: 19,974,192 I241V probably benign Het
Cfap46 A T 7: 139,654,629 L237* probably null Het
Col4a3 T A 1: 82,716,365 C133S probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Dnhd1 T A 7: 105,694,153 V1568D probably damaging Het
Fam208b T C 13: 3,575,049 T1634A probably benign Het
Gli3 C T 13: 15,725,996 Q1323* probably null Het
Gm884 A G 11: 103,534,641 V1462A unknown Het
Grhpr A G 4: 44,989,045 N287S probably damaging Het
Hectd4 G A 5: 121,318,624 W684* probably null Het
Kifc3 A G 8: 95,105,772 V474A probably damaging Het
Mdn1 A T 4: 32,667,089 probably null Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Nid1 T C 13: 13,483,790 Y707H probably benign Het
Nol4 A T 18: 22,770,681 N339K probably damaging Het
Olfr799 A T 10: 129,647,544 K139* probably null Het
Rbm34 C T 8: 126,970,893 G23S possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Snap25 A T 2: 136,758,348 E37V probably damaging Het
Taf1a A G 1: 183,397,837 T118A possibly damaging Het
Thrb T A 14: 18,008,642 I122K probably damaging Het
Xkr4 T G 1: 3,216,813 I385L probably benign Het
Other mutations in Zeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zeb1 APN 18 5767774 missense probably benign 0.00
IGL01139:Zeb1 APN 18 5705061 missense possibly damaging 0.69
IGL01444:Zeb1 APN 18 5767906 missense probably damaging 1.00
IGL01444:Zeb1 APN 18 5767138 missense probably benign
IGL01806:Zeb1 APN 18 5767867 missense possibly damaging 0.94
IGL01988:Zeb1 APN 18 5759037 nonsense probably null
IGL02059:Zeb1 APN 18 5766892 missense probably damaging 1.00
IGL03005:Zeb1 APN 18 5767150 missense probably benign 0.03
IGL03153:Zeb1 APN 18 5770511 missense probably damaging 1.00
cellophane UTSW 18 5770554 nonsense probably null
serpens UTSW 18 5772455 missense probably damaging 1.00
N/A - 293:Zeb1 UTSW 18 5767076 missense possibly damaging 0.68
R0184:Zeb1 UTSW 18 5766808 missense probably damaging 1.00
R0488:Zeb1 UTSW 18 5772455 missense probably damaging 1.00
R0622:Zeb1 UTSW 18 5759123 nonsense probably null
R0646:Zeb1 UTSW 18 5759027 missense probably damaging 1.00
R0881:Zeb1 UTSW 18 5767138 missense probably benign
R1251:Zeb1 UTSW 18 5705089 missense probably damaging 1.00
R1501:Zeb1 UTSW 18 5761399 missense possibly damaging 0.95
R1547:Zeb1 UTSW 18 5767450 missense possibly damaging 0.50
R1797:Zeb1 UTSW 18 5766298 nonsense probably null
R1815:Zeb1 UTSW 18 5767898 missense probably damaging 1.00
R2090:Zeb1 UTSW 18 5766458 missense possibly damaging 0.65
R2129:Zeb1 UTSW 18 5767681 missense possibly damaging 0.92
R2875:Zeb1 UTSW 18 5772859 small insertion probably benign
R3888:Zeb1 UTSW 18 5748743 missense probably damaging 1.00
R3941:Zeb1 UTSW 18 5767799 missense probably benign 0.06
R3952:Zeb1 UTSW 18 5772716 missense probably benign 0.17
R4271:Zeb1 UTSW 18 5758985 missense probably damaging 0.99
R4512:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4514:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4677:Zeb1 UTSW 18 5766775 missense probably damaging 0.97
R4729:Zeb1 UTSW 18 5767286 missense probably damaging 1.00
R5839:Zeb1 UTSW 18 5767507 missense probably benign
R5913:Zeb1 UTSW 18 5766765 missense possibly damaging 0.49
R6248:Zeb1 UTSW 18 5766962 missense probably damaging 1.00
R6354:Zeb1 UTSW 18 5772743 missense possibly damaging 0.64
R6429:Zeb1 UTSW 18 5770498 missense probably damaging 1.00
R6819:Zeb1 UTSW 18 5591917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGAAAAGCCCTATCAATGTGAC -3'
(R):5'- CACTGTACCATCAGTCTTGGCTGC -3'

Sequencing Primer
(F):5'- GCCCTATCAATGTGACAAGTGTG -3'
(R):5'- tcctcctcttcctcctcttc -3'
Posted On2014-01-29