Incidental Mutation 'R1258:Rfwd3'
ID151521
Institutional Source Beutler Lab
Gene Symbol Rfwd3
Ensembl Gene ENSMUSG00000033596
Gene Namering finger and WD repeat domain 3
Synonyms
MMRRC Submission 039325-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R1258 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111270944-111300222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111288242 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 326 (R326Q)
Ref Sequence ENSEMBL: ENSMUSP00000043780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038739]
Predicted Effect probably damaging
Transcript: ENSMUST00000038739
AA Change: R326Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043780
Gene: ENSMUSG00000033596
AA Change: R326Q

DomainStartEndE-ValueType
low complexity region 222 243 N/A INTRINSIC
RING 288 331 3.78e-5 SMART
coiled coil region 355 403 N/A INTRINSIC
WD40 486 526 1.38e-2 SMART
WD40 529 568 6.43e-3 SMART
Blast:WD40 683 730 2e-12 BLAST
Blast:WD40 733 772 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212958
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male fertility (possibly infertility), gonad atrophy, oligospermia, failure of follicular development, increased cellular sensitivity to MMC treatment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 133,937,447 E112G probably damaging Het
Ccar2 T C 14: 70,152,673 N17D probably benign Het
Dnajc9 G A 14: 20,388,697 probably null Het
Igsf9 G A 1: 172,492,155 R339H probably benign Het
Inpp5a G T 7: 139,525,744 G212C probably damaging Het
Itsn2 A G 12: 4,673,464 E1133G probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Pcdhb17 A T 18: 37,485,534 I126L probably damaging Het
Ppil2 A T 16: 17,106,053 L44H probably damaging Het
Qtrt2 A G 16: 43,869,083 V184A possibly damaging Het
Sall3 G A 18: 80,974,065 A216V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
St8sia6 T C 2: 13,656,884 M379V probably benign Het
Ubr4 T A 4: 139,426,914 L2144H probably damaging Het
Ythdf1 C A 2: 180,911,310 A371S probably benign Het
Zdhhc16 G A 19: 41,938,044 V89M possibly damaging Het
Zfp37 A T 4: 62,191,817 Y375N probably damaging Het
Zmat3 A T 3: 32,343,671 N147K probably damaging Het
Other mutations in Rfwd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Rfwd3 APN 8 111273075 missense possibly damaging 0.53
IGL02193:Rfwd3 APN 8 111273015 utr 3 prime probably benign
IGL02282:Rfwd3 APN 8 111293982 splice site probably benign
IGL02903:Rfwd3 APN 8 111278229 missense probably benign 0.00
R0254:Rfwd3 UTSW 8 111294023 missense probably benign
R0279:Rfwd3 UTSW 8 111282733 missense probably benign 0.00
R0531:Rfwd3 UTSW 8 111293989 critical splice donor site probably null
R1137:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1164:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1168:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1191:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1192:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1259:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1260:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1261:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1439:Rfwd3 UTSW 8 111278288 missense probably damaging 1.00
R1579:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1580:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1581:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1727:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1763:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1774:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1785:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R1786:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2059:Rfwd3 UTSW 8 111297495 missense probably benign 0.20
R2130:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2132:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2133:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2145:Rfwd3 UTSW 8 111282613 missense probably benign
R2174:Rfwd3 UTSW 8 111283343 missense probably damaging 0.98
R3897:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R4625:Rfwd3 UTSW 8 111276358 missense probably benign 0.01
R5121:Rfwd3 UTSW 8 111282753 splice site probably null
R5480:Rfwd3 UTSW 8 111273832 missense probably damaging 0.96
R5781:Rfwd3 UTSW 8 111273084 missense probably benign 0.02
Z1088:Rfwd3 UTSW 8 111297606 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGCAGGGATCGGGCATAAATGAC -3'
(R):5'- TGTTTAAGGCTCCACCTCAGACACC -3'

Sequencing Primer
(F):5'- TGACAACGATGTCACTGTGC -3'
(R):5'- Acacccccatccccacc -3'
Posted On2014-01-29