Mutagenetix > Incidental Mutation

Incidental Mutation 'R1259:Vmn2r12'

151539

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r12

Ensembl Gene

ENSMUSG00000090688

Gene Name

vomeronasal 2, receptor 12

Synonyms

Gm6769

MMRRC Submission

039326-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R1259 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109233715-109245730 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109239763 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 267 (I267F)

Ref Sequence

ENSEMBL: ENSMUSP00000093612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095922]

AlphaFold

L7N217

Predicted Effect

probably damaging
Transcript: ENSMUST00000095922
AA Change: I267F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: I267F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	76	466	8.8e-30	PFAM
Pfam:NCD3G	505	559	1.7e-18	PFAM
Pfam:7tm_3	591	827	3.9e-54	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	T	A	8: 44,021,684 (GRCm39)	D602V	probably benign	Het
Adam26a	T	C	8: 44,021,750 (GRCm39)	D580G	possibly damaging	Het
B4galt6	T	G	18: 20,839,559 (GRCm39)	E125A	possibly damaging	Het
Dnm1l	A	G	16: 16,141,870 (GRCm39)	I292T	possibly damaging	Het
Elp3	A	T	14: 65,785,388 (GRCm39)	I471K	probably damaging	Het
Fbxw13	A	T	9: 109,014,439 (GRCm39)	V83E	probably damaging	Het
Gm5422	T	C	10: 31,125,111 (GRCm39)		noncoding transcript	Het
Krtap6-5	C	T	16: 88,844,607 (GRCm39)	R42H	unknown	Het
Lpcat2b	C	T	5: 107,581,763 (GRCm39)	A364V	probably damaging	Het
Ltbp1	A	G	17: 75,532,280 (GRCm39)	Q118R	possibly damaging	Het
Lypd9	A	G	11: 58,338,296 (GRCm39)	I32T	probably benign	Het
Med7	C	G	11: 46,331,460 (GRCm39)	I18M	probably damaging	Het
Muc6	T	A	7: 141,226,464 (GRCm39)		probably benign	Het
Or8b42	T	A	9: 38,342,169 (GRCm39)	L197Q	probably damaging	Het
Or8k16	T	A	2: 85,519,875 (GRCm39)	I34N	probably damaging	Het
Pbrm1	T	C	14: 30,796,771 (GRCm39)	F871L	probably damaging	Het
Pgbd5	T	A	8: 125,097,324 (GRCm39)	D493V	probably damaging	Het
Pik3cd	G	A	4: 149,735,105 (GRCm39)	R1046*	probably null	Het
Pom121l2	G	A	13: 22,166,297 (GRCm39)	W189*	probably null	Het
Prex2	C	A	1: 11,359,494 (GRCm39)	N1567K	probably damaging	Het
Prl	A	G	13: 27,245,472 (GRCm39)		probably null	Het
Ptpro	T	C	6: 137,369,739 (GRCm39)	V517A	probably damaging	Het
Rfwd3	C	T	8: 112,014,874 (GRCm39)	R326Q	probably damaging	Het
Tenm2	C	T	11: 35,954,004 (GRCm39)	G1236R	possibly damaging	Het
Wasf3	T	C	5: 146,388,786 (GRCm39)	V80A	probably damaging	Het

Other mutations in Vmn2r12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00948:Vmn2r12	APN	5	109,245,541 (GRCm39)	missense	possibly damaging	0.47
IGL01096:Vmn2r12	APN	5	109,234,125 (GRCm39)	missense	probably damaging	1.00
IGL01538:Vmn2r12	APN	5	109,239,716 (GRCm39)	missense	probably damaging	1.00
IGL01548:Vmn2r12	APN	5	109,240,893 (GRCm39)	nonsense	probably null
IGL01762:Vmn2r12	APN	5	109,234,430 (GRCm39)	missense	probably damaging	0.99
IGL01860:Vmn2r12	APN	5	109,240,025 (GRCm39)	missense	probably benign	0.10
IGL02269:Vmn2r12	APN	5	109,234,343 (GRCm39)	missense	probably damaging	1.00
IGL02530:Vmn2r12	APN	5	109,233,858 (GRCm39)	missense	probably damaging	1.00
IGL02887:Vmn2r12	APN	5	109,238,351 (GRCm39)	missense	probably benign	0.03
IGL03265:Vmn2r12	APN	5	109,239,936 (GRCm39)	missense	probably benign	0.05
R0396:Vmn2r12	UTSW	5	109,240,765 (GRCm39)	missense	probably benign	0.00
R0497:Vmn2r12	UTSW	5	109,239,755 (GRCm39)	nonsense	probably null
R0529:Vmn2r12	UTSW	5	109,240,714 (GRCm39)	missense	probably benign
R0715:Vmn2r12	UTSW	5	109,238,373 (GRCm39)	missense	probably benign	0.10
R0742:Vmn2r12	UTSW	5	109,234,281 (GRCm39)	missense	possibly damaging	0.55
R0894:Vmn2r12	UTSW	5	109,235,716 (GRCm39)	critical splice donor site	probably null
R1173:Vmn2r12	UTSW	5	109,240,720 (GRCm39)	missense	probably benign	0.00
R1174:Vmn2r12	UTSW	5	109,240,720 (GRCm39)	missense	probably benign	0.00
R1349:Vmn2r12	UTSW	5	109,234,452 (GRCm39)	missense	probably benign	0.00
R1388:Vmn2r12	UTSW	5	109,240,840 (GRCm39)	missense	possibly damaging	0.56
R1549:Vmn2r12	UTSW	5	109,240,696 (GRCm39)	missense	probably benign	0.06
R1766:Vmn2r12	UTSW	5	109,239,910 (GRCm39)	missense	probably damaging	1.00
R1781:Vmn2r12	UTSW	5	109,239,594 (GRCm39)	missense	probably benign	0.00
R1885:Vmn2r12	UTSW	5	109,239,942 (GRCm39)	missense	probably damaging	1.00
R2159:Vmn2r12	UTSW	5	109,239,340 (GRCm39)	missense	probably benign	0.02
R2420:Vmn2r12	UTSW	5	109,234,398 (GRCm39)	missense	probably benign	0.39
R2421:Vmn2r12	UTSW	5	109,234,398 (GRCm39)	missense	probably benign	0.39
R2422:Vmn2r12	UTSW	5	109,234,398 (GRCm39)	missense	probably benign	0.39
R2937:Vmn2r12	UTSW	5	109,239,397 (GRCm39)	missense	probably damaging	1.00
R2938:Vmn2r12	UTSW	5	109,239,397 (GRCm39)	missense	probably damaging	1.00
R3898:Vmn2r12	UTSW	5	109,238,370 (GRCm39)	missense	probably benign	0.02
R4061:Vmn2r12	UTSW	5	109,240,058 (GRCm39)	missense	possibly damaging	0.95
R4063:Vmn2r12	UTSW	5	109,240,058 (GRCm39)	missense	possibly damaging	0.95
R4090:Vmn2r12	UTSW	5	109,239,412 (GRCm39)	missense	probably benign	0.06
R4297:Vmn2r12	UTSW	5	109,239,830 (GRCm39)	missense	probably benign	0.12
R4298:Vmn2r12	UTSW	5	109,239,830 (GRCm39)	missense	probably benign	0.12
R4299:Vmn2r12	UTSW	5	109,239,830 (GRCm39)	missense	probably benign	0.12
R4304:Vmn2r12	UTSW	5	109,233,872 (GRCm39)	missense	probably damaging	1.00
R4306:Vmn2r12	UTSW	5	109,233,872 (GRCm39)	missense	probably damaging	1.00
R4307:Vmn2r12	UTSW	5	109,233,872 (GRCm39)	missense	probably damaging	1.00
R4308:Vmn2r12	UTSW	5	109,233,872 (GRCm39)	missense	probably damaging	1.00
R4594:Vmn2r12	UTSW	5	109,234,301 (GRCm39)	missense	probably damaging	1.00
R4783:Vmn2r12	UTSW	5	109,234,379 (GRCm39)	missense	probably damaging	1.00
R4900:Vmn2r12	UTSW	5	109,240,852 (GRCm39)	missense	probably damaging	1.00
R4929:Vmn2r12	UTSW	5	109,239,544 (GRCm39)	missense	probably damaging	1.00
R4974:Vmn2r12	UTSW	5	109,239,372 (GRCm39)	missense	probably damaging	1.00
R5389:Vmn2r12	UTSW	5	109,238,261 (GRCm39)	missense	probably benign	0.00
R5431:Vmn2r12	UTSW	5	109,239,684 (GRCm39)	missense	probably damaging	0.99
R5527:Vmn2r12	UTSW	5	109,234,483 (GRCm39)	nonsense	probably null
R5639:Vmn2r12	UTSW	5	109,240,666 (GRCm39)	missense	probably benign	0.06
R5753:Vmn2r12	UTSW	5	109,239,670 (GRCm39)	missense	probably damaging	1.00
R5797:Vmn2r12	UTSW	5	109,233,736 (GRCm39)	nonsense	probably null
R6142:Vmn2r12	UTSW	5	109,240,763 (GRCm39)	missense	probably benign
R6162:Vmn2r12	UTSW	5	109,234,430 (GRCm39)	missense	probably damaging	0.99
R6176:Vmn2r12	UTSW	5	109,233,866 (GRCm39)	missense	probably benign	0.43
R6853:Vmn2r12	UTSW	5	109,240,771 (GRCm39)	missense	probably damaging	1.00
R7238:Vmn2r12	UTSW	5	109,245,655 (GRCm39)	missense	possibly damaging	0.81
R7341:Vmn2r12	UTSW	5	109,239,811 (GRCm39)	missense	possibly damaging	0.95
R7341:Vmn2r12	UTSW	5	109,234,113 (GRCm39)	missense	possibly damaging	0.74
R7383:Vmn2r12	UTSW	5	109,240,684 (GRCm39)	missense	probably benign	0.19
R7740:Vmn2r12	UTSW	5	109,239,615 (GRCm39)	missense	probably damaging	1.00
R7749:Vmn2r12	UTSW	5	109,233,920 (GRCm39)	missense	probably damaging	0.99
R7861:Vmn2r12	UTSW	5	109,235,829 (GRCm39)	missense	probably benign	0.00
R7908:Vmn2r12	UTSW	5	109,234,307 (GRCm39)	missense	probably damaging	1.00
R8128:Vmn2r12	UTSW	5	109,239,747 (GRCm39)	missense	possibly damaging	0.81
R8175:Vmn2r12	UTSW	5	109,238,349 (GRCm39)	missense	probably damaging	0.97
R8234:Vmn2r12	UTSW	5	109,234,074 (GRCm39)	missense	probably benign	0.01
R8771:Vmn2r12	UTSW	5	109,239,952 (GRCm39)	missense	possibly damaging	0.95
R8947:Vmn2r12	UTSW	5	109,234,522 (GRCm39)	missense	possibly damaging	0.64
R8991:Vmn2r12	UTSW	5	109,234,033 (GRCm39)	nonsense	probably null
R9116:Vmn2r12	UTSW	5	109,233,885 (GRCm39)	missense	probably damaging	1.00
R9122:Vmn2r12	UTSW	5	109,240,910 (GRCm39)	missense	probably benign	0.00
R9153:Vmn2r12	UTSW	5	109,234,203 (GRCm39)	missense	probably damaging	1.00
R9371:Vmn2r12	UTSW	5	109,234,452 (GRCm39)	missense	probably benign	0.00
R9375:Vmn2r12	UTSW	5	109,233,986 (GRCm39)	missense	probably damaging	1.00
R9524:Vmn2r12	UTSW	5	109,239,823 (GRCm39)	missense	probably damaging	1.00
R9587:Vmn2r12	UTSW	5	109,239,322 (GRCm39)	missense	probably damaging	0.99
Z1088:Vmn2r12	UTSW	5	109,240,646 (GRCm39)	missense	probably benign
Z1176:Vmn2r12	UTSW	5	109,239,303 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGTGTGCAAAAGTGACAGTCCC -3'
(R):5'- CAATGTCCATCAGGTAGCCACCAAG -3'

Sequencing Primer
(F):5'- TGACAGTCCCTTGGAAGAAATC -3'
(R):5'- CCTTGATGCTTCATTTTAGATGGAC -3'

Posted On

2014-01-29