Incidental Mutation 'R1259:Adam26a'
ID151545
Institutional Source Beutler Lab
Gene Symbol Adam26a
Ensembl Gene ENSMUSG00000048516
Gene Namea disintegrin and metallopeptidase domain 26A (testase 3)
SynonymsDtgn4, Adam26
MMRRC Submission 039326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1259 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43568278-43576707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43568713 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 580 (D580G)
Ref Sequence ENSEMBL: ENSMUSP00000058256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049577
AA Change: D580G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058256
Gene: ENSMUSG00000048516
AA Change: D580G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 2.1e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 2.2e-9 PFAM
Pfam:Reprolysin 195 385 2.7e-48 PFAM
Pfam:Reprolysin_2 215 377 2.4e-16 PFAM
Pfam:Reprolysin_3 219 340 1.2e-15 PFAM
DISIN 401 476 2.98e-41 SMART
ACR 477 613 2.06e-64 SMART
transmembrane domain 671 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during the late stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to two other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik A G 11: 58,447,470 I32T probably benign Het
B4galt6 T G 18: 20,706,502 E125A possibly damaging Het
Dnm1l A G 16: 16,324,006 I292T possibly damaging Het
Elp3 A T 14: 65,547,939 I471K probably damaging Het
Fbxw13 A T 9: 109,185,371 V83E probably damaging Het
Gm5422 T C 10: 31,249,115 noncoding transcript Het
Krtap6-5 C T 16: 89,047,719 R42H unknown Het
Lpcat2b C T 5: 107,433,897 A364V probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Muc6 T A 7: 141,640,197 probably benign Het
Olfr1008 T A 2: 85,689,531 I34N probably damaging Het
Olfr901 T A 9: 38,430,873 L197Q probably damaging Het
Pbrm1 T C 14: 31,074,814 F871L probably damaging Het
Pgbd5 T A 8: 124,370,585 D493V probably damaging Het
Pik3cd G A 4: 149,650,648 R1046* probably null Het
Pom121l2 G A 13: 21,982,127 W189* probably null Het
Prex2 C A 1: 11,289,270 N1567K probably damaging Het
Prl A G 13: 27,061,489 probably null Het
Ptpro T C 6: 137,392,741 V517A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Vmn2r12 T A 5: 109,091,897 I267F probably damaging Het
Wasf3 T C 5: 146,451,976 V80A probably damaging Het
Other mutations in Adam26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Adam26a APN 8 43568859 missense possibly damaging 0.75
IGL00519:Adam26a APN 8 43569525 missense probably damaging 1.00
IGL00658:Adam26a APN 8 43568903 missense probably benign 0.00
IGL01514:Adam26a APN 8 43568448 missense probably benign
IGL01988:Adam26a APN 8 43569170 missense possibly damaging 0.68
IGL02030:Adam26a APN 8 43568857 missense probably benign 0.00
IGL02081:Adam26a APN 8 43570196 missense probably damaging 0.99
IGL02444:Adam26a APN 8 43569673 missense possibly damaging 0.46
IGL02734:Adam26a APN 8 43569775 missense probably benign 0.27
IGL03243:Adam26a APN 8 43568696 missense probably benign 0.14
IGL03350:Adam26a APN 8 43569552 nonsense probably null
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0324:Adam26a UTSW 8 43568453 missense probably benign
R0830:Adam26a UTSW 8 43568402 missense probably benign 0.23
R0960:Adam26a UTSW 8 43568763 missense probably damaging 1.00
R1259:Adam26a UTSW 8 43568647 missense probably benign 0.20
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1719:Adam26a UTSW 8 43570036 missense possibly damaging 0.93
R1750:Adam26a UTSW 8 43570189 missense possibly damaging 0.90
R1860:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1861:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1875:Adam26a UTSW 8 43569851 missense probably benign 0.37
R3959:Adam26a UTSW 8 43569871 missense probably benign 0.00
R4355:Adam26a UTSW 8 43570185 missense probably benign 0.35
R4604:Adam26a UTSW 8 43570051 missense probably benign 0.02
R4612:Adam26a UTSW 8 43568793 missense probably damaging 0.99
R4909:Adam26a UTSW 8 43570438 missense probably benign 0.08
R4937:Adam26a UTSW 8 43568881 missense probably damaging 1.00
R5112:Adam26a UTSW 8 43568856 missense probably benign 0.04
R5276:Adam26a UTSW 8 43570420 missense probably benign 0.30
R5406:Adam26a UTSW 8 43569104 missense probably damaging 1.00
R5501:Adam26a UTSW 8 43569904 nonsense probably null
R5955:Adam26a UTSW 8 43569852 missense probably benign 0.11
R6262:Adam26a UTSW 8 43569088 missense possibly damaging 0.91
R6847:Adam26a UTSW 8 43568428 missense probably benign 0.23
R6957:Adam26a UTSW 8 43568903 missense probably benign 0.00
Z1088:Adam26a UTSW 8 43569698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGTGACACCACAATGGCAG -3'
(R):5'- TCAACGTGATGAGCAGTGTCGG -3'

Sequencing Primer
(F):5'- CAGTGTTGTTTATTATTGCAGATTCC -3'
(R):5'- GTGCAGATGAAATTTGCTACATGG -3'
Posted On2014-01-29