Incidental Mutation 'R1259:Gm5422'
ID151551
Institutional Source Beutler Lab
Gene Symbol Gm5422
Ensembl Gene ENSMUSG00000039684
Gene Namepredicted pseudogene 5422
Synonyms
MMRRC Submission 039326-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R1259 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location31248140-31251045 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 31249115 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050717
SMART Domains Protein: ENSMUSP00000135967
Gene: ENSMUSG00000039684

DomainStartEndE-ValueType
low complexity region 44 61 N/A INTRINSIC
Pfam:PC_rep 438 474 6.8e-9 PFAM
Pfam:PC_rep 475 509 1.1e-8 PFAM
SCOP:d1gw5a_ 603 760 4e-4 SMART
PDB:4CR4|Z 648 901 1e-50 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216161
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik A G 11: 58,447,470 I32T probably benign Het
Adam26a T A 8: 43,568,647 D602V probably benign Het
Adam26a T C 8: 43,568,713 D580G possibly damaging Het
B4galt6 T G 18: 20,706,502 E125A possibly damaging Het
Dnm1l A G 16: 16,324,006 I292T possibly damaging Het
Elp3 A T 14: 65,547,939 I471K probably damaging Het
Fbxw13 A T 9: 109,185,371 V83E probably damaging Het
Krtap6-5 C T 16: 89,047,719 R42H unknown Het
Lpcat2b C T 5: 107,433,897 A364V probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Muc6 T A 7: 141,640,197 probably benign Het
Olfr1008 T A 2: 85,689,531 I34N probably damaging Het
Olfr901 T A 9: 38,430,873 L197Q probably damaging Het
Pbrm1 T C 14: 31,074,814 F871L probably damaging Het
Pgbd5 T A 8: 124,370,585 D493V probably damaging Het
Pik3cd G A 4: 149,650,648 R1046* probably null Het
Pom121l2 G A 13: 21,982,127 W189* probably null Het
Prex2 C A 1: 11,289,270 N1567K probably damaging Het
Prl A G 13: 27,061,489 probably null Het
Ptpro T C 6: 137,392,741 V517A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Vmn2r12 T A 5: 109,091,897 I267F probably damaging Het
Wasf3 T C 5: 146,451,976 V80A probably damaging Het
Other mutations in Gm5422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Gm5422 APN 10 31249436 exon noncoding transcript
IGL01569:Gm5422 APN 10 31249901 exon noncoding transcript
IGL01645:Gm5422 APN 10 31250073 exon noncoding transcript
IGL02273:Gm5422 APN 10 31250007 exon noncoding transcript
IGL02603:Gm5422 APN 10 31249440 exon noncoding transcript
IGL02928:Gm5422 APN 10 31250254 exon noncoding transcript
IGL03003:Gm5422 APN 10 31250844 exon noncoding transcript
IGL03274:Gm5422 APN 10 31250352 exon noncoding transcript
IGL03297:Gm5422 APN 10 31249731 exon noncoding transcript
ANU23:Gm5422 UTSW 10 31249436 exon noncoding transcript
R0010:Gm5422 UTSW 10 31249754 exon noncoding transcript
R0506:Gm5422 UTSW 10 31250322 exon noncoding transcript
R0560:Gm5422 UTSW 10 31249244 exon noncoding transcript
R0573:Gm5422 UTSW 10 31250160 exon noncoding transcript
R0652:Gm5422 UTSW 10 31249281 exon noncoding transcript
R1210:Gm5422 UTSW 10 31250723 intron noncoding transcript
R1352:Gm5422 UTSW 10 31250735 intron noncoding transcript
R1631:Gm5422 UTSW 10 31249806 exon noncoding transcript
R1707:Gm5422 UTSW 10 31248462 exon noncoding transcript
R1893:Gm5422 UTSW 10 31249613 exon noncoding transcript
R2011:Gm5422 UTSW 10 31248768 exon noncoding transcript
R2132:Gm5422 UTSW 10 31248933 exon noncoding transcript
R3427:Gm5422 UTSW 10 31248846 exon noncoding transcript
R3772:Gm5422 UTSW 10 31248514 exon noncoding transcript
R4703:Gm5422 UTSW 10 31249612 exon noncoding transcript
R5539:Gm5422 UTSW 10 31248650 exon noncoding transcript
R5603:Gm5422 UTSW 10 31250844 exon noncoding transcript
R5660:Gm5422 UTSW 10 31250052 exon noncoding transcript
R6124:Gm5422 UTSW 10 31249400 exon noncoding transcript
R6178:Gm5422 UTSW 10 31249692 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTTCCGAAAGTTTAGCCGTTTCCC -3'
(R):5'- GCCATTTGTTGCCATCATCAGTCAG -3'

Sequencing Primer
(F):5'- CCTGAATCTCTGAGATTGGCAC -3'
(R):5'- TTATCTTGACCAAAGGCGGC -3'
Posted On2014-01-29