Incidental Mutation 'R1261:Oas1h'
ID151600
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120861421-120873506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120871867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 335 (E335G)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000086368] [ENSMUST00000162096] [ENSMUST00000171820]
Predicted Effect probably benign
Transcript: ENSMUST00000072476
AA Change: E335G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: E335G

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086368
SMART Domains Protein: ENSMUSP00000083555
Gene: ENSMUSG00000066861

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 1.6e-13 PFAM
Pfam:OAS1_C 164 349 6.9e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162096
SMART Domains Protein: ENSMUSP00000124597
Gene: ENSMUSG00000066861

DomainStartEndE-ValueType
Pfam:NTP_transf_2 42 138 1.1e-9 PFAM
Pfam:OAS1_C 163 231 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171820
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arhgef38 T C 3: 133,160,863 E171G possibly damaging Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Bmp3 A T 5: 98,879,926 R468S probably damaging Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Klk5 T C 7: 43,845,290 S66P probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Olfr1002 A C 2: 85,647,799 I174S probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc10a1 T A 12: 80,967,830 M39L probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Tmprss11d T C 5: 86,309,380 D140G possibly damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 120871834 missense probably damaging 1.00
IGL01890:Oas1h APN 5 120862789 unclassified probably null
IGL02745:Oas1h APN 5 120861479 missense probably benign 0.04
IGL02888:Oas1h APN 5 120861547 missense probably benign 0.34
IGL02970:Oas1h APN 5 120861635 missense possibly damaging 0.91
R0125:Oas1h UTSW 5 120862563 nonsense probably null
R1506:Oas1h UTSW 5 120871888 missense possibly damaging 0.66
R1565:Oas1h UTSW 5 120862600 missense probably damaging 0.97
R1696:Oas1h UTSW 5 120862822 critical splice donor site probably null
R1750:Oas1h UTSW 5 120871777 splice site probably null
R3116:Oas1h UTSW 5 120861616 nonsense probably null
R4814:Oas1h UTSW 5 120862665 missense probably damaging 0.99
R4906:Oas1h UTSW 5 120867109 nonsense probably null
R4944:Oas1h UTSW 5 120862783 missense probably damaging 1.00
R4961:Oas1h UTSW 5 120871096 missense probably damaging 1.00
R5160:Oas1h UTSW 5 120871082 missense probably damaging 1.00
R5698:Oas1h UTSW 5 120870982 missense probably damaging 1.00
R5903:Oas1h UTSW 5 120870977 missense probably damaging 1.00
R6014:Oas1h UTSW 5 120867166 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACATGTCCTGACCCCGTGTTTAATC -3'
(R):5'- GCAGTTTACAAGCAGCTTGCCTTC -3'

Sequencing Primer
(F):5'- tgccccaggacacacag -3'
(R):5'- AGCTTGCCTTCACAGAAGTG -3'
Posted On2014-01-29