Incidental Mutation 'R1262:Btbd7'
ID151628
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene NameBTB (POZ) domain containing 7
SynonymsFUP1, E130118E17Rik, 5730507E09Rik
MMRRC Submission 039329-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R1262 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location102780797-102878471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102787951 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 852 (I852T)
Ref Sequence ENSEMBL: ENSMUSP00000152426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
Predicted Effect probably benign
Transcript: ENSMUST00000045652
AA Change: I852T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: I852T

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223554
AA Change: I852T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
BC048679 A G 7: 81,495,341 F85L probably benign Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cyp2b10 C T 7: 25,915,411 T281M probably benign Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Olfr623 G A 7: 103,660,441 P270S probably benign Het
Olfr648 A G 7: 104,179,416 probably null Het
Snx25 T A 8: 46,105,291 R80S probably damaging Het
Syt6 A T 3: 103,585,340 probably null Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Ttc7 C T 17: 87,340,936 T521I probably benign Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7083:Btbd7 UTSW 12 102788335 missense not run
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAAGAGAAGCTCCCAGCTAGTCAG -3'
(R):5'- GAGATGTCGTGTCAACAGTACCCC -3'

Sequencing Primer
(F):5'- CCAGCTAGTCAGTAACACTTCTG -3'
(R):5'- GAAACCATGTTTACAGACCTGG -3'
Posted On2014-01-29