Incidental Mutation 'R1262:Chmp7'
ID151631
Institutional Source Beutler Lab
Gene Symbol Chmp7
Ensembl Gene ENSMUSG00000034190
Gene Namecharged multivesicular body protein 7
Synonyms4930596K11Rik, 6330407G04Rik, CHMP family, member 7
MMRRC Submission 039329-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R1262 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location69717000-69732541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69719450 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 336 (M336I)
Ref Sequence ENSEMBL: ENSMUSP00000047700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036381]
Predicted Effect probably benign
Transcript: ENSMUST00000036381
AA Change: M336I

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047700
Gene: ENSMUSG00000034190
AA Change: M336I

DomainStartEndE-ValueType
low complexity region 143 163 N/A INTRINSIC
Pfam:Snf7 241 417 1.3e-24 PFAM
low complexity region 420 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225036
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
BC048679 A G 7: 81,495,341 F85L probably benign Het
Btbd7 A G 12: 102,787,951 I852T probably benign Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Cyp2b10 C T 7: 25,915,411 T281M probably benign Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Olfr623 G A 7: 103,660,441 P270S probably benign Het
Olfr648 A G 7: 104,179,416 probably null Het
Snx25 T A 8: 46,105,291 R80S probably damaging Het
Syt6 A T 3: 103,585,340 probably null Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Ttc7 C T 17: 87,340,936 T521I probably benign Het
Other mutations in Chmp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Chmp7 APN 14 69721323 missense probably damaging 0.99
IGL01304:Chmp7 APN 14 69718613 missense probably benign 0.08
IGL01339:Chmp7 APN 14 69719406 missense probably damaging 1.00
IGL01818:Chmp7 APN 14 69719167 missense probably damaging 1.00
IGL03005:Chmp7 APN 14 69719828 missense probably damaging 1.00
R0238:Chmp7 UTSW 14 69720997 missense probably damaging 0.98
R0238:Chmp7 UTSW 14 69720997 missense probably damaging 0.98
R0239:Chmp7 UTSW 14 69720997 missense probably damaging 0.98
R0239:Chmp7 UTSW 14 69720997 missense probably damaging 0.98
R0395:Chmp7 UTSW 14 69732456 missense probably benign
R0580:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R0815:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1136:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1137:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1168:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1206:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1260:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1261:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1460:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1530:Chmp7 UTSW 14 69732488 start codon destroyed probably null 0.68
R1579:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1581:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1843:Chmp7 UTSW 14 69719799 missense probably benign 0.00
R1851:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R2254:Chmp7 UTSW 14 69720956 missense probably damaging 0.96
R4075:Chmp7 UTSW 14 69732281 missense probably damaging 0.99
R4298:Chmp7 UTSW 14 69719201 splice site probably null
R4595:Chmp7 UTSW 14 69721229 missense probably damaging 0.96
R4665:Chmp7 UTSW 14 69720955 missense probably damaging 1.00
R4706:Chmp7 UTSW 14 69718561 missense probably benign 0.45
R4732:Chmp7 UTSW 14 69732296 missense probably damaging 0.98
R4733:Chmp7 UTSW 14 69732296 missense probably damaging 0.98
R5207:Chmp7 UTSW 14 69732306 missense probably benign 0.02
R5358:Chmp7 UTSW 14 69721235 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCAGGAACAAGGCTGCGTCAAG -3'
(R):5'- AGCTGGACACTGTTCAAGGCATC -3'

Sequencing Primer
(F):5'- GTTTGGAAAAGAGGCTTGAAGTCAG -3'
(R):5'- TTCAAGGCATCCTGGATCG -3'
Posted On2014-01-29