Incidental Mutation 'R1263:Npas2'
ID151636
Institutional Source Beutler Lab
Gene Symbol Npas2
Ensembl Gene ENSMUSG00000026077
Gene Nameneuronal PAS domain protein 2
SynonymsbHLHe9, MOP4
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1263 (G1)
Quality Score136
Status Not validated
Chromosome1
Chromosomal Location39193731-39363236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39334768 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 450 (Q450K)
Ref Sequence ENSEMBL: ENSMUSP00000054719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056815
AA Change: Q450K

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: Q450K

DomainStartEndE-ValueType
HLH 15 65 6.56e-10 SMART
PAS 84 150 4.28e-10 SMART
PAS 239 305 4.03e-6 SMART
PAC 311 354 6.2e-7 SMART
low complexity region 400 419 N/A INTRINSIC
coiled coil region 510 538 N/A INTRINSIC
low complexity region 563 583 N/A INTRINSIC
low complexity region 623 643 N/A INTRINSIC
low complexity region 745 768 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Npas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Npas2 APN 1 39333961 splice site probably benign
IGL02608:Npas2 APN 1 39345446 missense probably benign 0.06
IGL02882:Npas2 APN 1 39312996 missense probably benign 0.08
IGL02976:Npas2 APN 1 39287484 missense probably damaging 1.00
IGL03130:Npas2 APN 1 39313028 missense probably damaging 1.00
IGL03297:Npas2 APN 1 39292690 missense possibly damaging 0.71
R1514:Npas2 UTSW 1 39311854 missense possibly damaging 0.82
R1618:Npas2 UTSW 1 39300727 missense probably damaging 1.00
R1620:Npas2 UTSW 1 39333912 missense possibly damaging 0.68
R1844:Npas2 UTSW 1 39325375 missense probably damaging 1.00
R1868:Npas2 UTSW 1 39300678 missense probably benign 0.03
R1892:Npas2 UTSW 1 39345422 missense probably benign 0.00
R2002:Npas2 UTSW 1 39338195 missense probably benign 0.10
R3157:Npas2 UTSW 1 39347609 missense possibly damaging 0.92
R3551:Npas2 UTSW 1 39287562 missense probably benign 0.05
R4564:Npas2 UTSW 1 39287566 missense probably damaging 1.00
R4907:Npas2 UTSW 1 39361985 missense unknown
R5044:Npas2 UTSW 1 39347506 nonsense probably null
R5621:Npas2 UTSW 1 39359713 missense probably benign
R5779:Npas2 UTSW 1 39287571 missense possibly damaging 0.48
R5822:Npas2 UTSW 1 39347566 missense probably benign 0.00
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6155:Npas2 UTSW 1 39287476 missense probably damaging 1.00
R6193:Npas2 UTSW 1 39292762 missense probably damaging 1.00
R6220:Npas2 UTSW 1 39336061 missense probably benign 0.00
R6341:Npas2 UTSW 1 39300687 missense probably damaging 0.98
R6656:Npas2 UTSW 1 39361948 missense unknown
R6778:Npas2 UTSW 1 39325300 missense possibly damaging 0.92
R6803:Npas2 UTSW 1 39336049 missense probably benign 0.35
R7165:Npas2 UTSW 1 39292717 missense possibly damaging 0.79
R7250:Npas2 UTSW 1 39338107 missense probably damaging 1.00
R7268:Npas2 UTSW 1 39287577 missense probably damaging 0.98
R7284:Npas2 UTSW 1 39324467 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GACAACTTGTATGTCCCCTGCCTG -3'
(R):5'- TGACACCAGTTTTCACAGCCACAG -3'

Sequencing Primer
(F):5'- TGCCTGCTTCCTGGTTG -3'
(R):5'- TTTCACAGCCACAGGTGAAATG -3'
Posted On2014-01-29