Incidental Mutation 'R1263:Brd3'
ID151641
Institutional Source Beutler Lab
Gene Symbol Brd3
Ensembl Gene ENSMUSG00000026918
Gene Namebromodomain containing 3
SynonymsRINGL3, ORFX, 2410084F24Rik, Fsrg2
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27445579-27507662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 27462522 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 132 (F132C)
Ref Sequence ENSEMBL: ENSMUSP00000114422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028282] [ENSMUST00000077737] [ENSMUST00000113941] [ENSMUST00000138693] [ENSMUST00000147736] [ENSMUST00000154316] [ENSMUST00000164296]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028282
AA Change: F132C

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028282
Gene: ENSMUSG00000026918
AA Change: F132C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
PDB:2JNS|A 572 645 5e-37 PDB
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077737
AA Change: F132C

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076918
Gene: ENSMUSG00000026918
AA Change: F132C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
PDB:2JNS|A 572 645 5e-37 PDB
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113941
AA Change: F132C

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109574
Gene: ENSMUSG00000026918
AA Change: F132C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
Pfam:BET 589 653 1.2e-35 PFAM
coiled coil region 666 701 N/A INTRINSIC
low complexity region 708 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130932
Predicted Effect probably damaging
Transcript: ENSMUST00000138693
AA Change: F132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115755
Gene: ENSMUSG00000026918
AA Change: F132C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
PDB:2JNS|A 589 662 4e-37 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144758
Predicted Effect probably benign
Transcript: ENSMUST00000147736
SMART Domains Protein: ENSMUSP00000122009
Gene: ENSMUSG00000026918

DomainStartEndE-ValueType
BROMO 31 90 3.19e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154316
AA Change: F132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114422
Gene: ENSMUSG00000026918
AA Change: F132C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
PDB:2JNS|A 589 662 4e-37 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000164296
AA Change: F132C

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128812
Gene: ENSMUSG00000026918
AA Change: F132C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
Pfam:BET 572 636 1.5e-35 PFAM
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its homology to the gene encoding the RING3 protein, a serine/threonine kinase. The gene localizes to 9q34, a region which contains several major histocompatibility complex (MHC) genes. The function of the encoded protein is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Brd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Brd3 APN 2 27464089 missense possibly damaging 0.53
IGL01685:Brd3 APN 2 27459488 missense probably damaging 1.00
IGL01911:Brd3 APN 2 27459800 missense probably damaging 1.00
IGL02105:Brd3 APN 2 27459776 missense probably damaging 1.00
IGL02649:Brd3 APN 2 27454350 missense probably damaging 1.00
IGL02715:Brd3 APN 2 27454483 missense possibly damaging 0.66
IGL02825:Brd3 APN 2 27449263 missense probably damaging 1.00
IGL02898:Brd3 APN 2 27459741 missense possibly damaging 0.81
H8562:Brd3 UTSW 2 27450533 missense possibly damaging 0.53
R1449:Brd3 UTSW 2 27450251 splice site probably null
R1449:Brd3 UTSW 2 27457016 missense probably damaging 1.00
R4351:Brd3 UTSW 2 27457016 missense probably damaging 1.00
R4840:Brd3 UTSW 2 27449239 missense possibly damaging 0.94
R5049:Brd3 UTSW 2 27450577 intron probably benign
R5131:Brd3 UTSW 2 27453415 missense probably benign
R5185:Brd3 UTSW 2 27462448 missense probably damaging 1.00
R5213:Brd3 UTSW 2 27463948 missense possibly damaging 0.81
R5261:Brd3 UTSW 2 27463919 missense probably damaging 0.99
R5326:Brd3 UTSW 2 27450544 missense probably benign
R5661:Brd3 UTSW 2 27461572 missense possibly damaging 0.68
R6439:Brd3 UTSW 2 27463926 missense probably damaging 1.00
R6952:Brd3 UTSW 2 27454359 missense probably damaging 1.00
R7039:Brd3 UTSW 2 27456917 missense probably damaging 0.96
R7103:Brd3 UTSW 2 27450394 missense probably damaging 0.97
R7168:Brd3 UTSW 2 27454399 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCATGACACCTGTCCTACCTGTCAG -3'
(R):5'- AGCACTGTGACTTGGAACTTCTGC -3'

Sequencing Primer
(F):5'- GTCCTACCTGTCAGGCAAC -3'
(R):5'- attcccctgcctctgcc -3'
Posted On2014-01-29