Incidental Mutation 'R1263:Rfx7'
ID151665
Institutional Source Beutler Lab
Gene Symbol Rfx7
Ensembl Gene ENSMUSG00000037674
Gene Nameregulatory factor X, 7
Synonyms9930116O05Rik, D130086K05Rik, 2510005N23Rik, Rfxdc2
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72532240-72622937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72577047 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 57 (V57E)
Ref Sequence ENSEMBL: ENSMUSP00000138957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093820] [ENSMUST00000163401] [ENSMUST00000183372] [ENSMUST00000184015]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093820
AA Change: V57E

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091338
Gene: ENSMUSG00000037674
AA Change: V57E

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 101 185 3.1e-39 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163401
AA Change: V57E

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127192
Gene: ENSMUSG00000037674
AA Change: V57E

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 105 183 2.9e-33 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183372
AA Change: V57E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139195
Gene: ENSMUSG00000037674
AA Change: V57E

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-12 PDB
Pfam:RFX_DNA_binding 101 185 9e-40 PFAM
Pfam:Pox_D5 109 196 1.8e-8 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184015
AA Change: V57E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138957
Gene: ENSMUSG00000037674
AA Change: V57E

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-12 PDB
Pfam:RFX_DNA_binding 101 185 9e-40 PFAM
Pfam:Pox_D5 109 196 1.8e-8 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184851
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RFX7 is a member of the regulatory factor X (RFX) family of transcription factors (see RFX1, MIM 600006) (Aftab et al., 2008 [PubMed 18673564]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Rfx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rfx7 APN 9 72607690 missense probably damaging 1.00
IGL00323:Rfx7 APN 9 72617420 missense probably damaging 0.97
IGL00920:Rfx7 APN 9 72593356 missense probably damaging 1.00
IGL01317:Rfx7 APN 9 72618536 missense probably damaging 0.98
IGL01405:Rfx7 APN 9 72610344 missense probably benign 0.02
IGL01585:Rfx7 APN 9 72617061 missense probably benign 0.41
IGL02118:Rfx7 APN 9 72617204 missense probably benign
IGL02205:Rfx7 APN 9 72607650 missense probably damaging 1.00
IGL02608:Rfx7 APN 9 72617294 missense probably benign 0.00
IGL02629:Rfx7 APN 9 72619259 missense probably damaging 0.96
IGL02963:Rfx7 APN 9 72617616 missense probably benign 0.00
IGL03026:Rfx7 APN 9 72619685 missense probably damaging 1.00
IGL03033:Rfx7 APN 9 72532989 splice site probably benign
IGL03212:Rfx7 APN 9 72619161 missense probably benign 0.06
IGL03221:Rfx7 APN 9 72618806 missense probably damaging 0.99
R0365:Rfx7 UTSW 9 72619836 missense probably benign 0.15
R0449:Rfx7 UTSW 9 72610304 critical splice acceptor site probably null
R0464:Rfx7 UTSW 9 72618204 missense probably damaging 1.00
R0746:Rfx7 UTSW 9 72619106 missense probably benign 0.00
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1277:Rfx7 UTSW 9 72593312 missense probably benign 0.32
R1330:Rfx7 UTSW 9 72617265 missense probably benign 0.00
R1371:Rfx7 UTSW 9 72619575 missense probably damaging 1.00
R1605:Rfx7 UTSW 9 72611789 missense probably damaging 1.00
R1802:Rfx7 UTSW 9 72619637 missense possibly damaging 0.50
R1903:Rfx7 UTSW 9 72616811 missense probably damaging 1.00
R2018:Rfx7 UTSW 9 72617685 missense probably benign 0.01
R2050:Rfx7 UTSW 9 72617466 missense probably benign 0.01
R2190:Rfx7 UTSW 9 72617919 missense probably benign 0.00
R2208:Rfx7 UTSW 9 72617964 missense probably benign 0.00
R2921:Rfx7 UTSW 9 72617664 missense possibly damaging 0.63
R3978:Rfx7 UTSW 9 72615111 missense possibly damaging 0.80
R4231:Rfx7 UTSW 9 72619390 missense possibly damaging 0.77
R4243:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4244:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4245:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4261:Rfx7 UTSW 9 72616643 missense probably damaging 1.00
R4844:Rfx7 UTSW 9 72593242 nonsense probably null
R4902:Rfx7 UTSW 9 72617291 missense probably benign 0.05
R5432:Rfx7 UTSW 9 72593302 missense probably benign 0.35
R5627:Rfx7 UTSW 9 72532784 start gained probably benign
R5900:Rfx7 UTSW 9 72617256 missense probably benign
R5991:Rfx7 UTSW 9 72619538 missense possibly damaging 0.54
R6273:Rfx7 UTSW 9 72616997 missense possibly damaging 0.47
R6306:Rfx7 UTSW 9 72616955 missense possibly damaging 0.63
R6324:Rfx7 UTSW 9 72618414 missense probably damaging 1.00
R6437:Rfx7 UTSW 9 72618486 missense possibly damaging 0.66
R6860:Rfx7 UTSW 9 72616944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCTTAGGCTTTCTGTGAAAGGTA -3'
(R):5'- GGTGAATTCCAAAAGGCTAACCAACAAA -3'

Sequencing Primer
(F):5'- AGGCTTTCTGTGAAAGGTAATTTAG -3'
(R):5'- TCTTTCAGTAAACGTCAGCAAG -3'
Posted On2014-01-29