Incidental Mutation 'R1263:Olfr1385'
ID151670
Institutional Source Beutler Lab
Gene Symbol Olfr1385
Ensembl Gene ENSMUSG00000059729
Gene Nameolfactory receptor 1385
SynonymsMOR256-42P, MOR256-41P, Olfr1549-ps1, GA_x6K02T2QP88-5941817-5940888, MOR256-42P
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49489070-49497496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49495021 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 163 (M163L)
Ref Sequence ENSEMBL: ENSMUSP00000150035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071807] [ENSMUST00000214948]
Predicted Effect probably benign
Transcript: ENSMUST00000071807
AA Change: M163L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071710
Gene: ENSMUSG00000059729
AA Change: M163L

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.1e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 214 9.5e-6 PFAM
Pfam:7tm_1 41 289 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214948
AA Change: M163L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216450
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Olfr1385
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Olfr1385 APN 11 49494966 missense probably damaging 0.99
IGL02098:Olfr1385 APN 11 49495397 missense probably damaging 1.00
IGL03206:Olfr1385 APN 11 49494709 missense probably benign 0.05
IGL03402:Olfr1385 APN 11 49495046 missense probably benign
R0412:Olfr1385 UTSW 11 49494767 missense probably damaging 1.00
R1371:Olfr1385 UTSW 11 49494823 missense probably damaging 1.00
R1488:Olfr1385 UTSW 11 49495118 missense probably benign 0.07
R1835:Olfr1385 UTSW 11 49494670 missense probably damaging 1.00
R1923:Olfr1385 UTSW 11 49495304 missense probably damaging 0.97
R2290:Olfr1385 UTSW 11 49495030 missense probably benign
R3738:Olfr1385 UTSW 11 49495460 missense possibly damaging 0.56
R3739:Olfr1385 UTSW 11 49495460 missense possibly damaging 0.56
R4034:Olfr1385 UTSW 11 49495460 missense possibly damaging 0.56
R4193:Olfr1385 UTSW 11 49495307 missense probably damaging 1.00
R4406:Olfr1385 UTSW 11 49494917 missense probably benign 0.01
R5239:Olfr1385 UTSW 11 49494728 missense possibly damaging 0.93
R6713:Olfr1385 UTSW 11 49494957 missense probably damaging 1.00
R6861:Olfr1385 UTSW 11 49494805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACTGTGCCACAGCTTCTCATAAATC -3'
(R):5'- GCTTTAGCAATGTGTCCATAGGAGCC -3'

Sequencing Primer
(F):5'- TTGACAGGACCATCAGCTATG -3'
(R):5'- CCATAGGAGCCAAGAATTAATGTTGC -3'
Posted On2014-01-29