Incidental Mutation 'R1263:L3mbtl2'
ID151680
Institutional Source Beutler Lab
Gene Symbol L3mbtl2
Ensembl Gene ENSMUSG00000022394
Gene NameL3MBTL2 polycomb repressive complex 1 subunit
Synonymsm4mbt, 4732493N06Rik
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81663889-81688315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81682968 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 423 (T423A)
Ref Sequence ENSEMBL: ENSMUSP00000133967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023029] [ENSMUST00000072910] [ENSMUST00000172568] [ENSMUST00000172748] [ENSMUST00000173598] [ENSMUST00000174229]
Predicted Effect probably benign
Transcript: ENSMUST00000023029
AA Change: T423A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023029
Gene: ENSMUSG00000022394
AA Change: T423A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 6e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072910
SMART Domains Protein: ENSMUSP00000072682
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
LRRNT 31 65 3.72e-4 SMART
LRR 59 83 1e1 SMART
LRR_TYP 84 107 7.78e-3 SMART
LRR_TYP 108 131 5.81e-2 SMART
LRR_TYP 132 155 3.89e-3 SMART
LRR_TYP 156 179 6.42e-4 SMART
LRR 180 203 1.37e1 SMART
LRR_TYP 204 227 5.5e-3 SMART
LRR 252 275 3.24e0 SMART
LRR 276 299 2.92e1 SMART
LRRCT 309 357 3.81e-2 SMART
low complexity region 358 372 N/A INTRINSIC
LRRNT 394 428 1.51e-4 SMART
LRR 427 446 1.26e2 SMART
LRR 447 470 3.97e0 SMART
LRR 471 494 1.08e-1 SMART
LRR 496 518 6.23e1 SMART
LRR 519 542 9.48e0 SMART
LRR 544 566 6.96e0 SMART
LRR 568 590 1.14e0 SMART
LRR_TYP 591 614 7.09e-6 SMART
LRR 617 639 3.76e1 SMART
LRR 640 665 6.59e1 SMART
LRRCT 674 722 2.87e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172620
Predicted Effect probably benign
Transcript: ENSMUST00000172748
AA Change: T423A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134333
Gene: ENSMUSG00000022394
AA Change: T423A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 1e-13 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173598
SMART Domains Protein: ENSMUSP00000133834
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 5 28 1.08e-1 SMART
LRR 30 52 6.23e1 SMART
LRR 53 76 9.48e0 SMART
LRR 78 100 6.96e0 SMART
LRR 102 124 1.14e0 SMART
LRR_TYP 125 148 7.09e-6 SMART
LRR 151 173 3.76e1 SMART
LRR 174 199 6.59e1 SMART
LRRCT 208 256 2.87e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173761
Predicted Effect probably benign
Transcript: ENSMUST00000173898
SMART Domains Protein: ENSMUSP00000133981
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 21 40 1.26e2 SMART
LRR 41 64 3.97e0 SMART
LRR 65 88 1.08e-1 SMART
LRR 90 112 6.23e1 SMART
LRR 113 136 9.48e0 SMART
LRR 138 160 6.96e0 SMART
LRR 162 184 1.14e0 SMART
LRR_TYP 185 208 7.09e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174229
AA Change: T423A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133967
Gene: ENSMUSG00000022394
AA Change: T423A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 8e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174401
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit failure of the inner cell mass to form a normal primitive ectoderm capable of gastrulation leading to abnormal embryo development, embryonic growth arrest, and lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in L3mbtl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:L3mbtl2 APN 15 81684898 missense possibly damaging 0.89
IGL01380:L3mbtl2 APN 15 81671125 missense possibly damaging 0.75
IGL01479:L3mbtl2 APN 15 81676392 missense probably benign 0.05
IGL02943:L3mbtl2 APN 15 81686255 missense possibly damaging 0.56
IGL03406:L3mbtl2 APN 15 81681993 missense probably damaging 1.00
R0393:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0394:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0449:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0565:L3mbtl2 UTSW 15 81684286 splice site probably benign
R1426:L3mbtl2 UTSW 15 81676317 missense possibly damaging 0.95
R1542:L3mbtl2 UTSW 15 81682151 missense probably null 0.45
R1556:L3mbtl2 UTSW 15 81682002 missense probably benign 0.23
R1922:L3mbtl2 UTSW 15 81675621 missense probably damaging 1.00
R2135:L3mbtl2 UTSW 15 81682014 missense possibly damaging 0.94
R2237:L3mbtl2 UTSW 15 81684330 missense probably benign
R4112:L3mbtl2 UTSW 15 81681969 missense possibly damaging 0.90
R4577:L3mbtl2 UTSW 15 81686285 missense probably benign
R4583:L3mbtl2 UTSW 15 81684906 missense probably damaging 1.00
R4779:L3mbtl2 UTSW 15 81682612 missense probably benign
R4787:L3mbtl2 UTSW 15 81663974 utr 5 prime probably benign
R5448:L3mbtl2 UTSW 15 81684333 missense possibly damaging 0.93
R5776:L3mbtl2 UTSW 15 81684871 missense probably damaging 1.00
R6019:L3mbtl2 UTSW 15 81686942 missense probably benign 0.00
R6058:L3mbtl2 UTSW 15 81667354 missense probably benign
R6259:L3mbtl2 UTSW 15 81681927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCAAGGTCCCATTGTAGCC -3'
(R):5'- TGTATCCTCTCCACCAGATAGCCG -3'

Sequencing Primer
(F):5'- CCCATTGTAGCCTGGTTTGG -3'
(R):5'- AAGAGTGTCCTTAGGCTCAGC -3'
Posted On2014-01-29