Mutagenetix > Incidental Mutation

Incidental Mutation 'R1249:Rad50'

151707

Institutional Source

Beutler Lab

Gene Symbol

Rad50

Ensembl Gene

ENSMUSG00000020380

Gene Name

RAD50 double strand break repair protein

Synonyms

Rad50l, Mrell

MMRRC Submission

039316-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1249 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

53540346-53598146 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53582964 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 476 (E476D)

Ref Sequence

ENSEMBL: ENSMUSP00000020649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020649] [ENSMUST00000124352] [ENSMUST00000128483]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000020649
AA Change: E476D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020649
Gene: ENSMUSG00000020380
AA Change: E476D

Domain	Start	End	E-Value	Type
Pfam:AAA_23	6	295	1.8e-31	PFAM
coiled coil region	397	534	N/A	INTRINSIC
Pfam:Rad50_zn_hook	659	712	9.9e-16	PFAM
low complexity region	825	836	N/A	INTRINSIC
low complexity region	919	929	N/A	INTRINSIC
coiled coil region	1019	1075	N/A	INTRINSIC
Pfam:SbcCD_C	1174	1251	1.1e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000124352
AA Change: E476D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119618
Gene: ENSMUSG00000020380
AA Change: E476D

Domain	Start	End	E-Value	Type
Pfam:AAA_23	6	290	2.7e-24	PFAM
coiled coil region	397	469	N/A	INTRINSIC
Pfam:Rad50_zn_hook	597	652	1.9e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128483
AA Change: E476D

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120869
Gene: ENSMUSG00000020380
AA Change: E476D

Domain	Start	End	E-Value	Type
Pfam:AAA_23	6	295	6e-23	PFAM
coiled coil region	397	534	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152598

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a targeted hypomorphic mutation exhibit growth defects, predisposition toward cancer, progressive loss of hematopoietic and spermatogenic stem cells, and lethality due to bone marrow depletion. A null mutation results in embryonic death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8b2	A	C	3: 89,855,111 (GRCm39)	N586K	possibly damaging	Het
Clca3a2	T	C	3: 144,508,765 (GRCm39)	R685G	possibly damaging	Het
Cpxm2	A	G	7: 131,730,079 (GRCm39)		probably null	Het
Dsg4	A	T	18: 20,579,929 (GRCm39)	R45*	probably null	Het
Lama4	A	G	10: 38,951,474 (GRCm39)	E1073G	probably damaging	Het
Mug1	A	G	6: 121,826,420 (GRCm39)	I167V	probably benign	Het
Or4e2	G	A	14: 52,687,979 (GRCm39)	M36I	probably benign	Het
Prox1	C	T	1: 189,879,258 (GRCm39)	R640H	possibly damaging	Het
Sars1	A	G	3: 108,343,251 (GRCm39)	V80A	probably benign	Het
Setd2	T	A	9: 110,402,948 (GRCm39)	M1863K	probably damaging	Het
Slc13a1	G	T	6: 24,133,649 (GRCm39)	P201Q	probably benign	Het
Taok1	A	C	11: 77,462,463 (GRCm39)	W209G	probably damaging	Het
Vmn1r217	T	A	13: 23,298,818 (GRCm39)	H28L	probably benign	Het

Other mutations in Rad50

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00477:Rad50	APN	11	53,577,138 (GRCm39)	intron	probably benign
IGL00709:Rad50	APN	11	53,560,469 (GRCm39)	missense	possibly damaging	0.49
IGL01080:Rad50	APN	11	53,596,895 (GRCm39)	missense	probably damaging	1.00
IGL01357:Rad50	APN	11	53,597,848 (GRCm39)	missense	probably damaging	1.00
IGL01979:Rad50	APN	11	53,577,005 (GRCm39)	nonsense	probably null
IGL02481:Rad50	APN	11	53,570,876 (GRCm39)	missense	probably benign	0.20
IGL02483:Rad50	APN	11	53,570,876 (GRCm39)	missense	probably benign	0.20
IGL02673:Rad50	APN	11	53,579,067 (GRCm39)	missense	probably benign	0.19
IGL02754:Rad50	APN	11	53,592,883 (GRCm39)	missense	probably damaging	1.00
IGL03372:Rad50	APN	11	53,586,121 (GRCm39)	missense	probably benign	0.20
PIT4131001:Rad50	UTSW	11	53,585,726 (GRCm39)	critical splice donor site	probably null
R0035:Rad50	UTSW	11	53,545,854 (GRCm39)	splice site	probably benign
R0035:Rad50	UTSW	11	53,545,854 (GRCm39)	splice site	probably benign
R0270:Rad50	UTSW	11	53,558,852 (GRCm39)	missense	probably damaging	1.00
R0373:Rad50	UTSW	11	53,541,346 (GRCm39)	missense	probably damaging	1.00
R0567:Rad50	UTSW	11	53,545,783 (GRCm39)	missense	probably damaging	1.00
R1132:Rad50	UTSW	11	53,585,788 (GRCm39)	missense	possibly damaging	0.58
R1368:Rad50	UTSW	11	53,574,072 (GRCm39)	nonsense	probably null
R1501:Rad50	UTSW	11	53,578,978 (GRCm39)	missense	possibly damaging	0.68
R1506:Rad50	UTSW	11	53,570,312 (GRCm39)	missense	probably damaging	0.98
R1633:Rad50	UTSW	11	53,583,686 (GRCm39)	missense	probably benign	0.00
R1663:Rad50	UTSW	11	53,559,050 (GRCm39)	missense	probably benign	0.01
R1847:Rad50	UTSW	11	53,592,934 (GRCm39)	missense	possibly damaging	0.68
R1933:Rad50	UTSW	11	53,570,888 (GRCm39)	missense	probably benign	0.16
R2176:Rad50	UTSW	11	53,589,036 (GRCm39)	missense	probably benign	0.00
R2519:Rad50	UTSW	11	53,598,012 (GRCm39)	start gained	probably benign
R3027:Rad50	UTSW	11	53,586,208 (GRCm39)	missense	probably benign	0.00
R3894:Rad50	UTSW	11	53,569,697 (GRCm39)	missense	probably benign	0.01
R4181:Rad50	UTSW	11	53,592,832 (GRCm39)	missense	probably benign	0.00
R4302:Rad50	UTSW	11	53,592,832 (GRCm39)	missense	probably benign	0.00
R4836:Rad50	UTSW	11	53,541,480 (GRCm39)	missense	probably damaging	1.00
R4934:Rad50	UTSW	11	53,575,102 (GRCm39)	missense	probably benign	0.05
R5047:Rad50	UTSW	11	53,565,523 (GRCm39)	critical splice donor site	probably null
R5201:Rad50	UTSW	11	53,589,647 (GRCm39)	critical splice donor site	probably null
R5325:Rad50	UTSW	11	53,583,690 (GRCm39)	missense	probably benign	0.16
R5368:Rad50	UTSW	11	53,575,073 (GRCm39)	missense	probably benign	0.02
R5403:Rad50	UTSW	11	53,586,108 (GRCm39)	critical splice donor site	probably null
R5421:Rad50	UTSW	11	53,565,773 (GRCm39)	missense	probably benign	0.02
R6282:Rad50	UTSW	11	53,560,597 (GRCm39)	splice site	probably null
R6468:Rad50	UTSW	11	53,582,971 (GRCm39)	missense	possibly damaging	0.81
R6469:Rad50	UTSW	11	53,575,062 (GRCm39)	missense	probably benign	0.08
R6528:Rad50	UTSW	11	53,543,109 (GRCm39)	missense	probably damaging	1.00
R6704:Rad50	UTSW	11	53,589,745 (GRCm39)	missense	probably damaging	1.00
R6886:Rad50	UTSW	11	53,577,011 (GRCm39)	missense	probably benign	0.01
R7055:Rad50	UTSW	11	53,578,929 (GRCm39)	missense	probably benign	0.02
R7268:Rad50	UTSW	11	53,575,102 (GRCm39)	missense	probably benign	0.01
R7288:Rad50	UTSW	11	53,545,776 (GRCm39)	nonsense	probably null
R7375:Rad50	UTSW	11	53,543,055 (GRCm39)	splice site	probably null
R7380:Rad50	UTSW	11	53,586,223 (GRCm39)	missense	probably benign	0.00
R7467:Rad50	UTSW	11	53,545,735 (GRCm39)	missense	probably damaging	1.00
R7533:Rad50	UTSW	11	53,589,746 (GRCm39)	missense	probably damaging	1.00
R8289:Rad50	UTSW	11	53,589,685 (GRCm39)	nonsense	probably null
R8345:Rad50	UTSW	11	53,574,968 (GRCm39)	missense	probably benign	0.00
R8368:Rad50	UTSW	11	53,574,155 (GRCm39)	missense	possibly damaging	0.83
R8514:Rad50	UTSW	11	53,569,766 (GRCm39)	nonsense	probably null
R8986:Rad50	UTSW	11	53,541,354 (GRCm39)	missense	possibly damaging	0.64
R9182:Rad50	UTSW	11	53,583,590 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACCTCAGGTGTGCAGACTAACG -3'
(R):5'- TCTGAAGCAGAGGCAGCTTGATG -3'

Sequencing Primer
(F):5'- GGTACTTGTGATAATCACCCGAC -3'
(R):5'- GCTTGATGAGCTGAGGGAC -3'

Posted On

2014-01-29